\
| Variant ID: vg0222570184 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22570184 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TAAAAAAACTCACATGCTAACTTGAGATGAAAGTCAGACTCCTAATTGCAGCTCATGATTTTCTAAAAAAAATATCTAAGCGAATTCCCACAGTGAATTT[T/C]
ATCCTAGCTAAACCGTATAACAATAATAATATTAAAACAATATTCACCTGTGTCGATGTTTGAGATCGTGACTACGGTATTTTGATGGTATGGGGATTTT
AAAATCCCCATACCATCAAAATACCGTAGTCACGATCTCAAACATCGACACAGGTGAATATTGTTTTAATATTATTATTGTTATACGGTTTAGCTAGGAT[A/G]
AAATTCACTGTGGGAATTCGCTTAGATATTTTTTTTAGAAAATCATGAGCTGCAATTAGGAGTCTGACTTTCATCTCAAGTTAGCATGTGAGTTTTTTTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.60% | 5.90% | 0.28% | 0.17% | NA |
| All Indica | 2759 | 95.70% | 3.90% | 0.18% | 0.22% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 37.90% | 58.70% | 2.60% | 0.74% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.50% | 4.10% | 0.22% | 0.22% | NA |
| Indica III | 913 | 93.40% | 6.20% | 0.11% | 0.22% | NA |
| Indica Intermediate | 786 | 95.30% | 3.90% | 0.38% | 0.38% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 4.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222570184 | T -> DEL | N | N | silent_mutation | Average:36.728; most accessible tissue: Callus, score: 53.425 | N | N | N | N |
| vg0222570184 | T -> C | LOC_Os02g37350.1 | upstream_gene_variant ; 520.0bp to feature; MODIFIER | silent_mutation | Average:36.728; most accessible tissue: Callus, score: 53.425 | N | N | N | N |
| vg0222570184 | T -> C | LOC_Os02g37360.1 | downstream_gene_variant ; 2030.0bp to feature; MODIFIER | silent_mutation | Average:36.728; most accessible tissue: Callus, score: 53.425 | N | N | N | N |
| vg0222570184 | T -> C | LOC_Os02g37340-LOC_Os02g37350 | intergenic_region ; MODIFIER | silent_mutation | Average:36.728; most accessible tissue: Callus, score: 53.425 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222570184 | NA | 1.04E-18 | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222570184 | NA | 2.76E-19 | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222570184 | 5.80E-06 | NA | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222570184 | NA | 6.48E-18 | mr1119 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222570184 | 7.97E-06 | NA | mr1123 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222570184 | 1.26E-08 | 1.91E-20 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222570184 | 8.41E-09 | NA | mr1495 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222570184 | 1.31E-07 | 1.15E-19 | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222570184 | NA | 5.29E-18 | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222570184 | 9.61E-06 | 1.53E-18 | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222570184 | NA | 1.18E-19 | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222570184 | NA | 9.68E-18 | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222570184 | NA | 1.85E-17 | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222570184 | 2.45E-06 | NA | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222570184 | 4.81E-06 | 1.36E-14 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |