\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222570184:

Variant ID: vg0222570184 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22570184
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAAAAAACTCACATGCTAACTTGAGATGAAAGTCAGACTCCTAATTGCAGCTCATGATTTTCTAAAAAAAATATCTAAGCGAATTCCCACAGTGAATTT[T/C]
ATCCTAGCTAAACCGTATAACAATAATAATATTAAAACAATATTCACCTGTGTCGATGTTTGAGATCGTGACTACGGTATTTTGATGGTATGGGGATTTT

Reverse complement sequence

AAAATCCCCATACCATCAAAATACCGTAGTCACGATCTCAAACATCGACACAGGTGAATATTGTTTTAATATTATTATTGTTATACGGTTTAGCTAGGAT[A/G]
AAATTCACTGTGGGAATTCGCTTAGATATTTTTTTTAGAAAATCATGAGCTGCAATTAGGAGTCTGACTTTCATCTCAAGTTAGCATGTGAGTTTTTTTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.60% 5.90% 0.28% 0.17% NA
All Indica  2759 95.70% 3.90% 0.18% 0.22% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 37.90% 58.70% 2.60% 0.74% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 95.50% 4.10% 0.22% 0.22% NA
Indica III  913 93.40% 6.20% 0.11% 0.22% NA
Indica Intermediate  786 95.30% 3.90% 0.38% 0.38% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 94.40% 4.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222570184 T -> DEL N N silent_mutation Average:36.728; most accessible tissue: Callus, score: 53.425 N N N N
vg0222570184 T -> C LOC_Os02g37350.1 upstream_gene_variant ; 520.0bp to feature; MODIFIER silent_mutation Average:36.728; most accessible tissue: Callus, score: 53.425 N N N N
vg0222570184 T -> C LOC_Os02g37360.1 downstream_gene_variant ; 2030.0bp to feature; MODIFIER silent_mutation Average:36.728; most accessible tissue: Callus, score: 53.425 N N N N
vg0222570184 T -> C LOC_Os02g37340-LOC_Os02g37350 intergenic_region ; MODIFIER silent_mutation Average:36.728; most accessible tissue: Callus, score: 53.425 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222570184 NA 1.04E-18 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222570184 NA 2.76E-19 mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222570184 5.80E-06 NA mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222570184 NA 6.48E-18 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222570184 7.97E-06 NA mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222570184 1.26E-08 1.91E-20 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222570184 8.41E-09 NA mr1495 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222570184 1.31E-07 1.15E-19 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222570184 NA 5.29E-18 mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222570184 9.61E-06 1.53E-18 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222570184 NA 1.18E-19 mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222570184 NA 9.68E-18 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222570184 NA 1.85E-17 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222570184 2.45E-06 NA mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222570184 4.81E-06 1.36E-14 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251