\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222557148:

Variant ID: vg0222557148 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22557148
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTAAGAAAAACATCCTCCAAGATAATCCAAACAGCAGTAAAGAACGCGATCGACAGGGGACTGCGGTAATGCCGCGACGACCACGTCCACGAGCCTCTA[C/T]
TGAAGACGCGCACACCGCTTGACAGACCGGTGACCCCTTCGGCTGCCTCCACGGAAACGGCGCTATTCGAGGTTTGTTGTTGAGTCGTAAATTTTTCTTA

Reverse complement sequence

TAAGAAAAATTTACGACTCAACAACAAACCTCGAATAGCGCCGTTTCCGTGGAGGCAGCCGAAGGGGTCACCGGTCTGTCAAGCGGTGTGCGCGTCTTCA[G/A]
TAGAGGCTCGTGGACGTGGTCGTCGCGGCATTACCGCAGTCCCCTGTCGATCGCGTTCTTTACTGCTGTTTGGATTATCTTGGAGGATGTTTTTCTTAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.00% 46.60% 2.67% 0.74% NA
All Indica  2759 18.10% 77.10% 4.02% 0.76% NA
All Japonica  1512 96.80% 1.80% 0.66% 0.79% NA
Aus  269 90.30% 8.90% 0.74% 0.00% NA
Indica I  595 19.50% 73.80% 3.53% 3.19% NA
Indica II  465 5.40% 92.50% 1.72% 0.43% NA
Indica III  913 24.10% 70.00% 5.91% 0.00% NA
Indica Intermediate  786 17.70% 78.80% 3.56% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 91.70% 4.20% 1.79% 2.38% NA
Japonica Intermediate  241 98.80% 0.80% 0.41% 0.00% NA
VI/Aromatic  96 94.80% 1.00% 3.12% 1.04% NA
Intermediate  90 74.40% 24.40% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222557148 C -> T LOC_Os02g37309.1 missense_variant ; p.Val197Ile; MODERATE nonsynonymous_codon ; V197I Average:36.351; most accessible tissue: Zhenshan97 panicle, score: 77.482 unknown unknown TOLERATED 0.20
vg0222557148 C -> DEL LOC_Os02g37309.1 N frameshift_variant Average:36.351; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222557148 NA 9.74E-20 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222557148 NA 4.28E-08 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222557148 NA 6.66E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222557148 NA 2.97E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222557148 NA 7.98E-12 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222557148 NA 4.40E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222557148 4.58E-06 NA mr1913 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222557148 3.25E-06 NA mr1913 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222557148 NA 5.87E-39 mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222557148 NA 2.32E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251