\
| Variant ID: vg0222557148 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22557148 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACTAAGAAAAACATCCTCCAAGATAATCCAAACAGCAGTAAAGAACGCGATCGACAGGGGACTGCGGTAATGCCGCGACGACCACGTCCACGAGCCTCTA[C/T]
TGAAGACGCGCACACCGCTTGACAGACCGGTGACCCCTTCGGCTGCCTCCACGGAAACGGCGCTATTCGAGGTTTGTTGTTGAGTCGTAAATTTTTCTTA
TAAGAAAAATTTACGACTCAACAACAAACCTCGAATAGCGCCGTTTCCGTGGAGGCAGCCGAAGGGGTCACCGGTCTGTCAAGCGGTGTGCGCGTCTTCA[G/A]
TAGAGGCTCGTGGACGTGGTCGTCGCGGCATTACCGCAGTCCCCTGTCGATCGCGTTCTTTACTGCTGTTTGGATTATCTTGGAGGATGTTTTTCTTAGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.00% | 46.60% | 2.67% | 0.74% | NA |
| All Indica | 2759 | 18.10% | 77.10% | 4.02% | 0.76% | NA |
| All Japonica | 1512 | 96.80% | 1.80% | 0.66% | 0.79% | NA |
| Aus | 269 | 90.30% | 8.90% | 0.74% | 0.00% | NA |
| Indica I | 595 | 19.50% | 73.80% | 3.53% | 3.19% | NA |
| Indica II | 465 | 5.40% | 92.50% | 1.72% | 0.43% | NA |
| Indica III | 913 | 24.10% | 70.00% | 5.91% | 0.00% | NA |
| Indica Intermediate | 786 | 17.70% | 78.80% | 3.56% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 91.70% | 4.20% | 1.79% | 2.38% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 1.00% | 3.12% | 1.04% | NA |
| Intermediate | 90 | 74.40% | 24.40% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222557148 | C -> T | LOC_Os02g37309.1 | missense_variant ; p.Val197Ile; MODERATE | nonsynonymous_codon ; V197I | Average:36.351; most accessible tissue: Zhenshan97 panicle, score: 77.482 | unknown | unknown | TOLERATED | 0.20 |
| vg0222557148 | C -> DEL | LOC_Os02g37309.1 | N | frameshift_variant | Average:36.351; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222557148 | NA | 9.74E-20 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222557148 | NA | 4.28E-08 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222557148 | NA | 6.66E-09 | mr1457 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222557148 | NA | 2.97E-14 | mr1592 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222557148 | NA | 7.98E-12 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222557148 | NA | 4.40E-07 | mr1716 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222557148 | 4.58E-06 | NA | mr1913 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222557148 | 3.25E-06 | NA | mr1913 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222557148 | NA | 5.87E-39 | mr1110_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222557148 | NA | 2.32E-06 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |