\
| Variant ID: vg0222556989 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22556989 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTCAACTCTCAGTTTGTTTTTTTTTTTGAAAACTCATAAATTTATTCATATAGTGAGGATTACAGACAGAGCTCAAAGGAAATGGCATCCCCAGAACATC[G/A]
CCATAAAAGATAAGACATAAAAAACAACACCATCCATTCAGAAGGTAAAGCTAGCTGAACTAAGAAAAACATCCTCCAAGATAATCCAAACAGCAGTAAA
TTTACTGCTGTTTGGATTATCTTGGAGGATGTTTTTCTTAGTTCAGCTAGCTTTACCTTCTGAATGGATGGTGTTGTTTTTTATGTCTTATCTTTTATGG[C/T]
GATGTTCTGGGGATGCCATTTCCTTTGAGCTCTGTCTGTAATCCTCACTATATGAATAAATTTATGAGTTTTCAAAAAAAAAAACAAACTGAGAGTTGAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.90% | 6.30% | 20.21% | 20.57% | NA |
| All Indica | 2759 | 22.70% | 10.30% | 33.60% | 33.42% | NA |
| All Japonica | 1512 | 97.00% | 0.00% | 0.73% | 2.31% | NA |
| Aus | 269 | 90.70% | 3.30% | 3.72% | 2.23% | NA |
| Indica I | 595 | 26.20% | 5.00% | 35.29% | 33.45% | NA |
| Indica II | 465 | 6.20% | 16.80% | 39.78% | 37.20% | NA |
| Indica III | 913 | 30.00% | 8.80% | 28.15% | 33.08% | NA |
| Indica Intermediate | 786 | 21.20% | 12.20% | 34.99% | 31.55% | NA |
| Temperate Japonica | 767 | 99.50% | 0.00% | 0.26% | 0.26% | NA |
| Tropical Japonica | 504 | 92.10% | 0.00% | 1.59% | 6.35% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 3.30% | 7.78% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222556989 | G -> A | LOC_Os02g37309.1 | stop_gained ; p.Arg250*; HIGH | stop_gained | Average:44.679; most accessible tissue: Callus, score: 82.918 | N | N | N | N |
| vg0222556989 | G -> DEL | LOC_Os02g37309.1 | N | frameshift_variant | Average:44.679; most accessible tissue: Callus, score: 82.918 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222556989 | NA | 2.03E-18 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222556989 | 2.64E-06 | NA | mr1098 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222556989 | 4.89E-06 | NA | mr1101 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222556989 | 2.89E-06 | NA | mr1148 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222556989 | NA | 1.54E-09 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222556989 | NA | 4.59E-09 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222556989 | NA | 2.27E-38 | mr1110_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222556989 | 6.81E-06 | NA | mr1124_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222556989 | NA | 5.19E-06 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |