| Variant ID: vg0222556850 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22556850 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATAAAGTACTTAAAGAATTTGATGGGTGATTGAGAACAAAATGTAAATAGAAAAAATATCATATTTTAGAATAAATTTCAAAAAGTAAATCGTCAATCGA[T/C]
GCGGCCGTGTAAGTTCAGAGCGGACAAGAGCCAACAACCTCAACTCTCAGTTTGTTTTTTTTTTTGAAAACTCATAAATTTATTCATATAGTGAGGATTA
TAATCCTCACTATATGAATAAATTTATGAGTTTTCAAAAAAAAAAACAAACTGAGAGTTGAGGTTGTTGGCTCTTGTCCGCTCTGAACTTACACGGCCGC[A/G]
TCGATTGACGATTTACTTTTTGAAATTTATTCTAAAATATGATATTTTTTCTATTTACATTTTGTTCTCAATCACCCATCAAATTCTTTAAGTACTTTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.90% | 38.30% | 0.30% | 0.51% | NA |
| All Indica | 2759 | 90.40% | 8.20% | 0.47% | 0.87% | NA |
| All Japonica | 1512 | 4.30% | 95.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 80.80% | 18.30% | 0.50% | 0.34% | NA |
| Indica II | 465 | 95.70% | 1.90% | 1.08% | 1.29% | NA |
| Indica III | 913 | 94.30% | 4.20% | 0.33% | 1.20% | NA |
| Indica Intermediate | 786 | 90.10% | 9.00% | 0.25% | 0.64% | NA |
| Temperate Japonica | 767 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 10.70% | 89.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 13.50% | 86.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 40.00% | 58.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222556850 | T -> DEL | N | N | silent_mutation | Average:44.179; most accessible tissue: Minghui63 root, score: 68.826 | N | N | N | N |
| vg0222556850 | T -> C | LOC_Os02g37300.1 | upstream_gene_variant ; 2737.0bp to feature; MODIFIER | silent_mutation | Average:44.179; most accessible tissue: Minghui63 root, score: 68.826 | N | N | N | N |
| vg0222556850 | T -> C | LOC_Os02g37309.1 | downstream_gene_variant ; 62.0bp to feature; MODIFIER | silent_mutation | Average:44.179; most accessible tissue: Minghui63 root, score: 68.826 | N | N | N | N |
| vg0222556850 | T -> C | LOC_Os02g37320.1 | downstream_gene_variant ; 2245.0bp to feature; MODIFIER | silent_mutation | Average:44.179; most accessible tissue: Minghui63 root, score: 68.826 | N | N | N | N |
| vg0222556850 | T -> C | LOC_Os02g37300-LOC_Os02g37309 | intergenic_region ; MODIFIER | silent_mutation | Average:44.179; most accessible tissue: Minghui63 root, score: 68.826 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222556850 | NA | 1.38E-11 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222556850 | NA | 1.18E-29 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222556850 | NA | 1.07E-31 | mr1074 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222556850 | NA | 2.46E-30 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222556850 | NA | 1.82E-40 | mr1124 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222556850 | NA | 7.80E-15 | mr1146 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222556850 | NA | 1.53E-27 | mr1148 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222556850 | NA | 4.49E-24 | mr1150 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222556850 | NA | 6.31E-32 | mr1202 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222556850 | NA | 4.22E-08 | mr1222 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/