Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222556850:

Variant ID: vg0222556850 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 22556850
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAAAGTACTTAAAGAATTTGATGGGTGATTGAGAACAAAATGTAAATAGAAAAAATATCATATTTTAGAATAAATTTCAAAAAGTAAATCGTCAATCGA[T/C]
GCGGCCGTGTAAGTTCAGAGCGGACAAGAGCCAACAACCTCAACTCTCAGTTTGTTTTTTTTTTTGAAAACTCATAAATTTATTCATATAGTGAGGATTA

Reverse complement sequence

TAATCCTCACTATATGAATAAATTTATGAGTTTTCAAAAAAAAAAACAAACTGAGAGTTGAGGTTGTTGGCTCTTGTCCGCTCTGAACTTACACGGCCGC[A/G]
TCGATTGACGATTTACTTTTTGAAATTTATTCTAAAATATGATATTTTTTCTATTTACATTTTGTTCTCAATCACCCATCAAATTCTTTAAGTACTTTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.90%	38.30%	0.30%	0.51%	NA
All Indica	2759	90.40%	8.20%	0.47%	0.87%	NA
All Japonica	1512	4.30%	95.70%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	80.80%	18.30%	0.50%	0.34%	NA
Indica II	465	95.70%	1.90%	1.08%	1.29%	NA
Indica III	913	94.30%	4.20%	0.33%	1.20%	NA
Indica Intermediate	786	90.10%	9.00%	0.25%	0.64%	NA
Temperate Japonica	767	0.80%	99.20%	0.00%	0.00%	NA
Tropical Japonica	504	10.70%	89.30%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	13.50%	86.50%	0.00%	0.00%	NA
Intermediate	90	40.00%	58.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222556850	T -> DEL	N	N	silent_mutation	Average:44.179; most accessible tissue: Minghui63 root, score: 68.826	N	N	N	N
vg0222556850	T -> C	LOC_Os02g37300.1	upstream_gene_variant ; 2737.0bp to feature; MODIFIER	silent_mutation	Average:44.179; most accessible tissue: Minghui63 root, score: 68.826	N	N	N	N
vg0222556850	T -> C	LOC_Os02g37309.1	downstream_gene_variant ; 62.0bp to feature; MODIFIER	silent_mutation	Average:44.179; most accessible tissue: Minghui63 root, score: 68.826	N	N	N	N
vg0222556850	T -> C	LOC_Os02g37320.1	downstream_gene_variant ; 2245.0bp to feature; MODIFIER	silent_mutation	Average:44.179; most accessible tissue: Minghui63 root, score: 68.826	N	N	N	N
vg0222556850	T -> C	LOC_Os02g37300-LOC_Os02g37309	intergenic_region ; MODIFIER	silent_mutation	Average:44.179; most accessible tissue: Minghui63 root, score: 68.826	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222556850	NA	1.38E-11	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	NA	1.18E-29	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	NA	1.07E-31	mr1074	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	NA	2.46E-30	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	NA	1.82E-40	mr1124	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	NA	7.80E-15	mr1146	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	NA	1.53E-27	mr1148	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	NA	4.49E-24	mr1150	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	NA	6.31E-32	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	NA	4.22E-08	mr1222	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	NA	6.07E-54	mr1861	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	NA	1.92E-59	mr1962	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	7.34E-07	NA	mr1067_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	6.11E-07	NA	mr1067_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	1.76E-07	7.44E-43	mr1072_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	3.35E-08	2.41E-43	mr1075_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	2.76E-06	1.74E-23	mr1077_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	1.16E-06	NA	mr1080_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	1.32E-07	NA	mr1100_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	NA	6.24E-57	mr1124_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	3.65E-06	2.08E-29	mr1149_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	NA	9.22E-32	mr1150_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	NA	1.29E-17	mr1281_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	NA	5.41E-61	mr1402_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	4.48E-06	4.17E-29	mr1441_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	NA	1.18E-18	mr1592_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	NA	1.14E-12	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	NA	2.04E-10	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	5.21E-06	NA	mr1613_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	NA	7.03E-19	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	1.59E-06	NA	mr1795_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	NA	7.01E-48	mr1861_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	NA	1.81E-09	mr1947_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	3.36E-09	NA	mr1962_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850	5.95E-09	NA	mr1962_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251