\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222556850:

Variant ID: vg0222556850 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22556850
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAAAGTACTTAAAGAATTTGATGGGTGATTGAGAACAAAATGTAAATAGAAAAAATATCATATTTTAGAATAAATTTCAAAAAGTAAATCGTCAATCGA[T/C]
GCGGCCGTGTAAGTTCAGAGCGGACAAGAGCCAACAACCTCAACTCTCAGTTTGTTTTTTTTTTTGAAAACTCATAAATTTATTCATATAGTGAGGATTA

Reverse complement sequence

TAATCCTCACTATATGAATAAATTTATGAGTTTTCAAAAAAAAAAACAAACTGAGAGTTGAGGTTGTTGGCTCTTGTCCGCTCTGAACTTACACGGCCGC[A/G]
TCGATTGACGATTTACTTTTTGAAATTTATTCTAAAATATGATATTTTTTCTATTTACATTTTGTTCTCAATCACCCATCAAATTCTTTAAGTACTTTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.90% 38.30% 0.30% 0.51% NA
All Indica  2759 90.40% 8.20% 0.47% 0.87% NA
All Japonica  1512 4.30% 95.70% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 80.80% 18.30% 0.50% 0.34% NA
Indica II  465 95.70% 1.90% 1.08% 1.29% NA
Indica III  913 94.30% 4.20% 0.33% 1.20% NA
Indica Intermediate  786 90.10% 9.00% 0.25% 0.64% NA
Temperate Japonica  767 0.80% 99.20% 0.00% 0.00% NA
Tropical Japonica  504 10.70% 89.30% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 40.00% 58.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222556850 T -> DEL N N silent_mutation Average:44.179; most accessible tissue: Minghui63 root, score: 68.826 N N N N
vg0222556850 T -> C LOC_Os02g37300.1 upstream_gene_variant ; 2737.0bp to feature; MODIFIER silent_mutation Average:44.179; most accessible tissue: Minghui63 root, score: 68.826 N N N N
vg0222556850 T -> C LOC_Os02g37309.1 downstream_gene_variant ; 62.0bp to feature; MODIFIER silent_mutation Average:44.179; most accessible tissue: Minghui63 root, score: 68.826 N N N N
vg0222556850 T -> C LOC_Os02g37320.1 downstream_gene_variant ; 2245.0bp to feature; MODIFIER silent_mutation Average:44.179; most accessible tissue: Minghui63 root, score: 68.826 N N N N
vg0222556850 T -> C LOC_Os02g37300-LOC_Os02g37309 intergenic_region ; MODIFIER silent_mutation Average:44.179; most accessible tissue: Minghui63 root, score: 68.826 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222556850 NA 1.38E-11 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 NA 1.18E-29 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 NA 1.07E-31 mr1074 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 NA 2.46E-30 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 NA 1.82E-40 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 NA 7.80E-15 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 NA 1.53E-27 mr1148 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 NA 4.49E-24 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 NA 6.31E-32 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 NA 4.22E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 NA 6.07E-54 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 NA 1.92E-59 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 7.34E-07 NA mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 6.11E-07 NA mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 1.76E-07 7.44E-43 mr1072_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 3.35E-08 2.41E-43 mr1075_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 2.76E-06 1.74E-23 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 1.16E-06 NA mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 1.32E-07 NA mr1100_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 NA 6.24E-57 mr1124_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 3.65E-06 2.08E-29 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 NA 9.22E-32 mr1150_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 NA 1.29E-17 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 NA 5.41E-61 mr1402_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 4.48E-06 4.17E-29 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 NA 1.18E-18 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 NA 1.14E-12 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 NA 2.04E-10 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 5.21E-06 NA mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 NA 7.03E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 1.59E-06 NA mr1795_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 NA 7.01E-48 mr1861_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 NA 1.81E-09 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 3.36E-09 NA mr1962_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222556850 5.95E-09 NA mr1962_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251