\
| Variant ID: vg0222546189 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22546189 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TACAATTAGCAAAAGTCTGAATGGTGTAACTGTTCTTCACTTGGGAATTGAAGCTGGAGCTCTGTTGTGCAGAGGACCTCAGCTTGGTTAGCTTGCCGTG[C/G]
ATGAGGGAGAGCAGAGCCTGAGAACTCCCCTCCTTATATGGCTGTGTTTGCTAGGGGAGGATGGGAACATGCATAGTGCGCATGGAAAACGAAGTAGTCC
GGACTACTTCGTTTTCCATGCGCACTATGCATGTTCCCATCCTCCCCTAGCAAACACAGCCATATAAGGAGGGGAGTTCTCAGGCTCTGCTCTCCCTCAT[G/C]
CACGGCAAGCTAACCAAGCTGAGGTCCTCTGCACAACAGAGCTCCAGCTTCAATTCCCAAGTGAAGAACAGTTACACCATTCAGACTTTTGCTAATTGTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.70% | 2.80% | 0.78% | 56.69% | NA |
| All Indica | 2759 | 10.20% | 4.70% | 1.05% | 84.09% | NA |
| All Japonica | 1512 | 96.00% | 0.00% | 0.07% | 3.97% | NA |
| Aus | 269 | 2.20% | 0.00% | 1.86% | 95.91% | NA |
| Indica I | 595 | 23.90% | 0.20% | 1.01% | 74.96% | NA |
| Indica II | 465 | 7.30% | 0.20% | 0.43% | 92.04% | NA |
| Indica III | 913 | 2.40% | 11.60% | 0.66% | 85.32% | NA |
| Indica Intermediate | 786 | 10.60% | 2.70% | 1.91% | 84.86% | NA |
| Temperate Japonica | 767 | 99.30% | 0.00% | 0.00% | 0.65% | NA |
| Tropical Japonica | 504 | 89.70% | 0.00% | 0.20% | 10.12% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 86.50% | 2.10% | 0.00% | 11.46% | NA |
| Intermediate | 90 | 61.10% | 3.30% | 2.22% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222546189 | C -> G | LOC_Os02g37270.1 | upstream_gene_variant ; 4390.0bp to feature; MODIFIER | silent_mutation | Average:32.429; most accessible tissue: Callus, score: 82.796 | N | N | N | N |
| vg0222546189 | C -> G | LOC_Os02g37280.1 | upstream_gene_variant ; 364.0bp to feature; MODIFIER | silent_mutation | Average:32.429; most accessible tissue: Callus, score: 82.796 | N | N | N | N |
| vg0222546189 | C -> G | LOC_Os02g37290.1 | downstream_gene_variant ; 4792.0bp to feature; MODIFIER | silent_mutation | Average:32.429; most accessible tissue: Callus, score: 82.796 | N | N | N | N |
| vg0222546189 | C -> G | LOC_Os02g37280-LOC_Os02g37290 | intergenic_region ; MODIFIER | silent_mutation | Average:32.429; most accessible tissue: Callus, score: 82.796 | N | N | N | N |
| vg0222546189 | C -> DEL | N | N | silent_mutation | Average:32.429; most accessible tissue: Callus, score: 82.796 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222546189 | NA | 2.70E-13 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | NA | 2.07E-30 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | NA | 4.23E-31 | mr1074 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | NA | 7.17E-32 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | NA | 3.04E-19 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | 3.07E-06 | NA | mr1095 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | 4.52E-06 | NA | mr1101 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | 2.84E-06 | NA | mr1101 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | NA | 2.12E-41 | mr1124 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | NA | 1.08E-15 | mr1146 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | NA | 9.78E-27 | mr1148 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | NA | 1.85E-13 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | 5.01E-06 | 1.70E-24 | mr1150 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | NA | 1.09E-33 | mr1202 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | NA | 2.88E-08 | mr1222 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | NA | 9.45E-13 | mr1441 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | NA | 2.07E-15 | mr1592 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | NA | 4.88E-56 | mr1861 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | 1.72E-06 | NA | mr1868 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | 2.75E-06 | NA | mr1868 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | 7.26E-07 | 5.99E-07 | mr1913 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | NA | 8.83E-24 | mr1917 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | 3.56E-06 | NA | mr1918 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | 1.19E-06 | NA | mr1918 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | 8.05E-06 | NA | mr1929 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | NA | 2.61E-59 | mr1962 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | 8.33E-06 | 2.72E-42 | mr1072_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | 3.45E-06 | 7.96E-43 | mr1075_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | 1.52E-06 | NA | mr1098_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | 4.86E-06 | NA | mr1099_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | 1.40E-07 | NA | mr1099_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | 2.57E-06 | 3.06E-58 | mr1124_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | NA | 3.22E-29 | mr1149_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | 7.69E-06 | 9.06E-34 | mr1150_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | 4.97E-07 | NA | mr1150_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | NA | 1.87E-29 | mr1441_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | NA | 4.30E-18 | mr1592_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | NA | 3.74E-12 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | NA | 2.51E-10 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | NA | 1.32E-48 | mr1861_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | 2.59E-06 | NA | mr1918_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | 6.51E-06 | NA | mr1929_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222546189 | 7.69E-06 | NA | mr1962_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |