\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222533839:

Variant ID: vg0222533839 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22533839
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


AGAGCTAGAAATCTCAAGTTCGAATCCTGACTAACGCATAATTAAATAAAAATTGCAGCACACTTCTATTGCACGCTAGAGGCTTGAGGGGGCCTTGTGT[G/A]
AGGGGTTTGTTAGACAAATGTATATCCAGATTCATAGTAGTAGGATGTGTCACATTCAATGCTAGATTGGTTTTTTTATAGGACAGAGTGAGTAGATTGT

Reverse complement sequence

ACAATCTACTCACTCTGTCCTATAAAAAAACCAATCTAGCATTGAATGTGACACATCCTACTACTATGAATCTGGATATACATTTGTCTAACAAACCCCT[C/T]
ACACAAGGCCCCCTCAAGCCTCTAGCGTGCAATAGAAGTGTGCTGCAATTTTTATTTAATTATGCGTTAGTCAGGATTCGAACTTGAGATTTCTAGCTCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.10% 48.90% 0.95% 0.00% NA
All Indica  2759 76.00% 23.20% 0.83% 0.00% NA
All Japonica  1512 9.90% 89.00% 1.12% 0.00% NA
Aus  269 34.90% 64.30% 0.74% 0.00% NA
Indica I  595 77.30% 20.70% 2.02% 0.00% NA
Indica II  465 84.30% 15.30% 0.43% 0.00% NA
Indica III  913 74.60% 25.40% 0.00% 0.00% NA
Indica Intermediate  786 71.60% 27.20% 1.15% 0.00% NA
Temperate Japonica  767 0.80% 98.80% 0.39% 0.00% NA
Tropical Japonica  504 26.80% 70.40% 2.78% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 31.10% 65.60% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222533839 G -> A LOC_Os02g37260.1 upstream_gene_variant ; 2516.0bp to feature; MODIFIER silent_mutation Average:55.126; most accessible tissue: Callus, score: 71.132 N N N N
vg0222533839 G -> A LOC_Os02g37260-LOC_Os02g37270 intergenic_region ; MODIFIER silent_mutation Average:55.126; most accessible tissue: Callus, score: 71.132 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222533839 NA 1.05E-10 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839 NA 6.87E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839 NA 1.10E-13 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839 NA 1.49E-09 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839 NA 4.88E-10 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839 NA 5.89E-06 mr1109_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839 NA 1.49E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839 NA 1.44E-11 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839 NA 3.69E-07 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839 NA 5.83E-10 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839 NA 3.21E-09 mr1243_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839 NA 1.05E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839 NA 1.76E-08 mr1251_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839 NA 3.01E-08 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839 NA 4.39E-09 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839 NA 1.62E-08 mr1435_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839 NA 1.63E-08 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839 8.58E-06 8.58E-06 mr1603_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839 NA 2.36E-10 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839 NA 6.91E-09 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839 3.18E-07 NA mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839 NA 7.32E-09 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251