Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222533839:

Variant ID: vg0222533839 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 22533839
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

AGAGCTAGAAATCTCAAGTTCGAATCCTGACTAACGCATAATTAAATAAAAATTGCAGCACACTTCTATTGCACGCTAGAGGCTTGAGGGGGCCTTGTGT[G/A]
AGGGGTTTGTTAGACAAATGTATATCCAGATTCATAGTAGTAGGATGTGTCACATTCAATGCTAGATTGGTTTTTTTATAGGACAGAGTGAGTAGATTGT

Reverse complement sequence

ACAATCTACTCACTCTGTCCTATAAAAAAACCAATCTAGCATTGAATGTGACACATCCTACTACTATGAATCTGGATATACATTTGTCTAACAAACCCCT[C/T]
ACACAAGGCCCCCTCAAGCCTCTAGCGTGCAATAGAAGTGTGCTGCAATTTTTATTTAATTATGCGTTAGTCAGGATTCGAACTTGAGATTTCTAGCTCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.10%	48.90%	0.95%	0.00%	NA
All Indica	2759	76.00%	23.20%	0.83%	0.00%	NA
All Japonica	1512	9.90%	89.00%	1.12%	0.00%	NA
Aus	269	34.90%	64.30%	0.74%	0.00%	NA
Indica I	595	77.30%	20.70%	2.02%	0.00%	NA
Indica II	465	84.30%	15.30%	0.43%	0.00%	NA
Indica III	913	74.60%	25.40%	0.00%	0.00%	NA
Indica Intermediate	786	71.60%	27.20%	1.15%	0.00%	NA
Temperate Japonica	767	0.80%	98.80%	0.39%	0.00%	NA
Tropical Japonica	504	26.80%	70.40%	2.78%	0.00%	NA
Japonica Intermediate	241	3.30%	96.70%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	31.10%	65.60%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222533839	G -> A	LOC_Os02g37260.1	upstream_gene_variant ; 2516.0bp to feature; MODIFIER	silent_mutation	Average:55.126; most accessible tissue: Callus, score: 71.132	N	N	N	N
vg0222533839	G -> A	LOC_Os02g37260-LOC_Os02g37270	intergenic_region ; MODIFIER	silent_mutation	Average:55.126; most accessible tissue: Callus, score: 71.132	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222533839	NA	1.05E-10	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839	NA	6.87E-06	mr1227	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839	NA	1.10E-13	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839	NA	1.49E-09	mr1089_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839	NA	4.88E-10	mr1093_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839	NA	5.89E-06	mr1109_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839	NA	1.49E-06	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839	NA	1.44E-11	mr1188_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839	NA	3.69E-07	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839	NA	5.83E-10	mr1235_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839	NA	3.21E-09	mr1243_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839	NA	1.05E-07	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839	NA	1.76E-08	mr1251_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839	NA	3.01E-08	mr1257_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839	NA	4.39E-09	mr1423_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839	NA	1.62E-08	mr1435_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839	NA	1.63E-08	mr1599_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839	8.58E-06	8.58E-06	mr1603_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839	NA	2.36E-10	mr1784_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839	NA	6.91E-09	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839	3.18E-07	NA	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222533839	NA	7.32E-09	mr1862_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251