Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222525776:

Variant ID: vg0222525776 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 22525776
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.02, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

CGTATATACTTTTGTCTTGCTCTTGAGAAATTCAGAGATATTAACATGTTCTCTCTCTATATAATTTTACTACGTCAATTATCATGCTTCTTCAGTCCTA[C/T]
TTGGTGTTAATTTCATTATCATTTCACAGTCTATATAAAACACACTACTACAAAAACAATTTTTCATAGCACCATCCTTTTATTTTTACTGATCGGTTTA

Reverse complement sequence

TAAACCGATCAGTAAAAATAAAAGGATGGTGCTATGAAAAATTGTTTTTGTAGTAGTGTGTTTTATATAGACTGTGAAATGATAATGAAATTAACACCAA[G/A]
TAGGACTGAAGAAGCATGATAATTGACGTAGTAAAATTATATAGAGAGAGAACATGTTAATATCTCTGAATTTCTCAAGAGCAAGACAAAAGTATATACG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.90%	6.10%	0.78%	51.27%	NA
All Indica	2759	13.80%	3.20%	1.20%	81.77%	NA
All Japonica	1512	96.00%	0.10%	0.07%	3.84%	NA
Aus	269	1.90%	66.20%	0.74%	31.23%	NA
Indica I	595	25.20%	0.20%	1.34%	73.28%	NA
Indica II	465	6.00%	4.30%	1.51%	88.17%	NA
Indica III	913	11.00%	2.40%	1.10%	85.54%	NA
Indica Intermediate	786	13.10%	5.90%	1.02%	80.03%	NA
Temperate Japonica	767	99.30%	0.00%	0.00%	0.65%	NA
Tropical Japonica	504	89.70%	0.20%	0.20%	9.92%	NA
Japonica Intermediate	241	98.30%	0.40%	0.00%	1.24%	NA
VI/Aromatic	96	88.50%	11.50%	0.00%	0.00%	NA
Intermediate	90	63.30%	7.80%	1.11%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222525776	C -> T	LOC_Os02g37260.1	downstream_gene_variant ; 3609.0bp to feature; MODIFIER	silent_mutation	Average:12.772; most accessible tissue: Callus, score: 79.85	N	N	N	N
vg0222525776	C -> T	LOC_Os02g37254-LOC_Os02g37260	intergenic_region ; MODIFIER	silent_mutation	Average:12.772; most accessible tissue: Callus, score: 79.85	N	N	N	N
vg0222525776	C -> DEL	N	N	silent_mutation	Average:12.772; most accessible tissue: Callus, score: 79.85	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222525776	NA	1.12E-12	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222525776	NA	1.94E-28	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222525776	NA	1.26E-31	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222525776	NA	8.25E-21	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222525776	3.04E-06	NA	mr1098	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222525776	NA	3.69E-40	mr1124	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222525776	NA	6.25E-13	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222525776	1.96E-07	1.01E-23	mr1150	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222525776	2.66E-06	NA	mr1150	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222525776	NA	3.59E-32	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222525776	NA	8.67E-09	mr1222	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222525776	NA	9.95E-13	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222525776	NA	6.44E-14	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222525776	NA	1.69E-08	mr1595	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222525776	NA	3.29E-55	mr1861	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222525776	4.82E-06	NA	mr1918	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222525776	1.61E-06	6.26E-42	mr1072_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222525776	8.17E-08	3.33E-43	mr1075_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222525776	2.38E-06	1.20E-24	mr1077_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222525776	NA	1.57E-57	mr1124_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222525776	2.16E-06	5.58E-29	mr1149_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222525776	3.04E-06	1.31E-28	mr1441_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222525776	NA	1.56E-18	mr1592_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222525776	NA	1.75E-13	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222525776	NA	2.54E-11	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222525776	7.73E-06	NA	mr1918_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222525776	NA	9.03E-06	mr1982_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251