\
| Variant ID: vg0222523726 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22523726 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCTATTAGTACGAATTCGTCTAGCTATCGATCGGCACTGCAATCTAGCACCACCTATCACCATGCTGGCGGATCTTAGTAAAACCCACAAAAATCTCATG[T/C]
AAAGGTTCCACGAAATTGAAGAGTTGACATTAAGTTTGATTGCTGTGGTTTTTTTTTTTGTTGTTGAAAGTTTCTTATACTGAATGGGAAGAGTTTTACT
AGTAAAACTCTTCCCATTCAGTATAAGAAACTTTCAACAACAAAAAAAAAAACCACAGCAATCAAACTTAATGTCAACTCTTCAATTTCGTGGAACCTTT[A/G]
CATGAGATTTTTGTGGGTTTTACTAAGATCCGCCAGCATGGTGATAGGTGGTGCTAGATTGCAGTGCCGATCGATAGCTAGACGAATTCGTACTAATAGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.80% | 44.00% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 82.60% | 17.00% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 4.10% | 95.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 95.20% | 4.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 67.10% | 32.10% | 0.84% | 0.00% | NA |
| Indica II | 465 | 90.10% | 9.50% | 0.43% | 0.00% | NA |
| Indica III | 913 | 88.80% | 11.00% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 82.70% | 17.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 10.10% | 89.70% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 10.40% | 89.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 32.20% | 67.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222523726 | T -> C | LOC_Os02g37254-LOC_Os02g37260 | intergenic_region ; MODIFIER | silent_mutation | Average:31.922; most accessible tissue: Callus, score: 73.056 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222523726 | NA | 1.08E-26 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222523726 | NA | 2.03E-28 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222523726 | NA | 2.66E-22 | mr1150 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222523726 | NA | 4.79E-08 | mr1222 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222523726 | 4.16E-06 | NA | mr1225 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222523726 | NA | 1.50E-37 | mr1072_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222523726 | NA | 1.03E-38 | mr1075_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222523726 | NA | 1.70E-26 | mr1149_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222523726 | NA | 3.81E-17 | mr1592_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222523726 | NA | 2.28E-11 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222523726 | NA | 4.30E-09 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |