Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222484143:

Variant ID: vg0222484143 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 22484143
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATATAATGTAATTTCTAAATGTTGTCAAGACTATATTAGCATATCTAGACTGTCAAAGTACAATAATATTTTTTTTCCCTAGTAGGTGTAGATATCTAGT[A/G]
GCTCAGCTCTCCGTATATACATATCTAGACTGCCAAAGTACAATAATATATTCTTTTTAAAAAATATATATTGGTCCTACTATATATGTGGTCATAGCCT

Reverse complement sequence

AGGCTATGACCACATATATAGTAGGACCAATATATATTTTTTAAAAAGAATATATTATTGTACTTTGGCAGTCTAGATATGTATATACGGAGAGCTGAGC[T/C]
ACTAGATATCTACACCTACTAGGGAAAAAAAATATTATTGTACTTTGACAGTCTAGATATGCTAATATAGTCTTGACAACATTTAGAAATTACATTATAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.80%	3.80%	2.45%	0.00%	NA
All Indica	2759	97.20%	1.90%	0.87%	0.00%	NA
All Japonica	1512	87.20%	7.30%	5.49%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	89.60%	7.70%	2.69%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.10%	0.40%	0.44%	0.00%	NA
Indica Intermediate	786	99.10%	0.40%	0.51%	0.00%	NA
Temperate Japonica	767	91.40%	2.70%	5.87%	0.00%	NA
Tropical Japonica	504	87.70%	10.10%	2.18%	0.00%	NA
Japonica Intermediate	241	72.60%	16.20%	11.20%	0.00%	NA
VI/Aromatic	96	86.50%	7.30%	6.25%	0.00%	NA
Intermediate	90	87.80%	8.90%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222484143	A -> G	LOC_Os02g37200.1	upstream_gene_variant ; 1726.0bp to feature; MODIFIER	silent_mutation	Average:58.558; most accessible tissue: Zhenshan97 root, score: 81.564	N	N	N	N
vg0222484143	A -> G	LOC_Os02g37210.1	upstream_gene_variant ; 2014.0bp to feature; MODIFIER	silent_mutation	Average:58.558; most accessible tissue: Zhenshan97 root, score: 81.564	N	N	N	N
vg0222484143	A -> G	LOC_Os02g37220.1	upstream_gene_variant ; 3985.0bp to feature; MODIFIER	silent_mutation	Average:58.558; most accessible tissue: Zhenshan97 root, score: 81.564	N	N	N	N
vg0222484143	A -> G	LOC_Os02g37200-LOC_Os02g37210	intergenic_region ; MODIFIER	silent_mutation	Average:58.558; most accessible tissue: Zhenshan97 root, score: 81.564	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222484143	3.39E-06	9.19E-07	mr1554	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251