\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222471248:

Variant ID: vg0222471248 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22471248
Reference Allele: GAlternative Allele: C,A
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.53, G: 0.44, A: 0.03, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TATATCTACATGCATGATCATTTAATTTGCATGGTTCGTCGGCGTCACATCATCTATCGTCGATTGTTATCCCTCGCTACACTTGTAGAGATCGGTGATA[G/C,A]
TTATATTTCATCTTGGCACAATGACTAAGAATAAGTAATTTTACTTATCATTTATTTAAATATGCTACTAGTTATTTCTCATAAATAAGTGATTCATTAA

Reverse complement sequence

TTAATGAATCACTTATTTATGAGAAATAACTAGTAGCATATTTAAATAAATGATAAGTAAAATTACTTATTCTTAGTCATTGTGCCAAGATGAAATATAA[C/G,T]
TATCACCGATCTCTACAAGTGTAGCGAGGGATAACAATCGACGATAGATGATGTGACGCCGACGAACCATGCAAATTAAATGATCATGCATGTAGATATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.10% 6.10% 0.08% 0.00% A: 1.71%
All Indica  2759 94.20% 2.80% 0.07% 0.00% A: 2.90%
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 27.50% 72.10% 0.37% 0.00% NA
Indica I  595 99.50% 0.20% 0.34% 0.00% NA
Indica II  465 96.10% 3.70% 0.00% 0.00% A: 0.22%
Indica III  913 90.80% 2.00% 0.00% 0.00% A: 7.23%
Indica Intermediate  786 93.00% 5.30% 0.00% 0.00% A: 1.65%
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 10.40% 1.04% 0.00% NA
Intermediate  90 94.40% 4.40% 0.00% 0.00% A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222471248 G -> A LOC_Os02g37160.1 upstream_gene_variant ; 1460.0bp to feature; MODIFIER silent_mutation Average:48.546; most accessible tissue: Callus, score: 69.585 N N N N
vg0222471248 G -> A LOC_Os02g37170.1 downstream_gene_variant ; 428.0bp to feature; MODIFIER silent_mutation Average:48.546; most accessible tissue: Callus, score: 69.585 N N N N
vg0222471248 G -> A LOC_Os02g37180.1 downstream_gene_variant ; 3689.0bp to feature; MODIFIER silent_mutation Average:48.546; most accessible tissue: Callus, score: 69.585 N N N N
vg0222471248 G -> A LOC_Os02g37160-LOC_Os02g37170 intergenic_region ; MODIFIER silent_mutation Average:48.546; most accessible tissue: Callus, score: 69.585 N N N N
vg0222471248 G -> C LOC_Os02g37160.1 upstream_gene_variant ; 1460.0bp to feature; MODIFIER silent_mutation Average:48.546; most accessible tissue: Callus, score: 69.585 N N N N
vg0222471248 G -> C LOC_Os02g37170.1 downstream_gene_variant ; 428.0bp to feature; MODIFIER silent_mutation Average:48.546; most accessible tissue: Callus, score: 69.585 N N N N
vg0222471248 G -> C LOC_Os02g37180.1 downstream_gene_variant ; 3689.0bp to feature; MODIFIER silent_mutation Average:48.546; most accessible tissue: Callus, score: 69.585 N N N N
vg0222471248 G -> C LOC_Os02g37160-LOC_Os02g37170 intergenic_region ; MODIFIER silent_mutation Average:48.546; most accessible tissue: Callus, score: 69.585 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222471248 NA 8.73E-22 mr1095 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 7.65E-06 2.21E-30 mr1098 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 6.36E-07 5.49E-31 mr1099 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 1.82E-06 1.85E-31 mr1101 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 NA 3.60E-19 mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 NA 3.48E-23 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 NA 1.47E-17 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 3.06E-08 1.87E-28 mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 1.39E-06 2.94E-22 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 NA 8.35E-23 mr1120 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 7.15E-09 3.28E-33 mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 NA 9.90E-18 mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 6.49E-08 1.60E-24 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 NA 1.32E-22 mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 1.23E-08 NA mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 1.44E-08 1.24E-24 mr1496 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 6.94E-06 2.71E-24 mr1589 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 NA 2.45E-12 mr1612 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 NA 1.28E-25 mr1868 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 NA 1.00E-16 mr1911 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 NA 1.90E-18 mr1936 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 2.34E-06 5.96E-29 mr1098_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 4.19E-06 1.00E-24 mr1099_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 7.67E-07 1.81E-23 mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 1.53E-07 2.74E-23 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 1.77E-08 7.37E-27 mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 1.58E-06 NA mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 4.80E-07 3.41E-24 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 4.82E-07 1.87E-27 mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 2.36E-08 1.06E-28 mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 9.33E-06 1.44E-21 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 1.03E-07 1.39E-22 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 1.47E-08 1.27E-29 mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 9.28E-07 NA mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 6.21E-09 5.90E-20 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 NA 1.25E-16 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222471248 NA 1.13E-15 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251