Variant ID: vg0222439621 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 22439621 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 277. )
GCTGATTATTATTATTATTTTTTGTAAACTCCATGCTCTCGCATTATGTTAACAAATCCGGTCAAAATAAAATGAAGAAAATTAACACGAAATCTTGAAA[G/A]
CTGTCCTGACGACAAACTGAAGCATCTCACGTCCTTTGCATGAGCTAGTAGTAGCCTAGTACAAACCGCAACATCAACAGAAAAAAACATACACAACAAG
CTTGTTGTGTATGTTTTTTTCTGTTGATGTTGCGGTTTGTACTAGGCTACTACTAGCTCATGCAAAGGACGTGAGATGCTTCAGTTTGTCGTCAGGACAG[C/T]
TTTCAAGATTTCGTGTTAATTTTCTTCATTTTATTTTGACCGGATTTGTTAACATAATGCGAGAGCATGGAGTTTACAAAAAATAATAATAATAATCAGC
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 64.60% | 35.20% | 0.21% | 0.00% | NA |
All Indica | 2759 | 95.80% | 4.00% | 0.14% | 0.00% | NA |
All Japonica | 1512 | 5.40% | 94.20% | 0.40% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 92.30% | 7.60% | 0.17% | 0.00% | NA |
Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.00% | 0.90% | 0.11% | 0.00% | NA |
Indica Intermediate | 786 | 92.70% | 7.00% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 2.70% | 96.50% | 0.78% | 0.00% | NA |
Tropical Japonica | 504 | 10.50% | 89.50% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 16.70% | 83.30% | 0.00% | 0.00% | NA |
Intermediate | 90 | 47.80% | 52.20% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0222439621 | G -> A | LOC_Os02g37109.1 | downstream_gene_variant ; 4890.0bp to feature; MODIFIER | silent_mutation | Average:58.604; most accessible tissue: Callus, score: 82.558 | N | N | N | N |
vg0222439621 | G -> A | LOC_Os02g37109.2 | downstream_gene_variant ; 4890.0bp to feature; MODIFIER | silent_mutation | Average:58.604; most accessible tissue: Callus, score: 82.558 | N | N | N | N |
vg0222439621 | G -> A | LOC_Os02g37120.1 | intron_variant ; MODIFIER | silent_mutation | Average:58.604; most accessible tissue: Callus, score: 82.558 | N | N | N | N |
vg0222439621 | G -> A | LOC_Os02g37120.2 | intron_variant ; MODIFIER | silent_mutation | Average:58.604; most accessible tissue: Callus, score: 82.558 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0222439621 | NA | 6.02E-29 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222439621 | NA | 1.84E-29 | mr1202 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222439621 | NA | 8.36E-08 | mr1222 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222439621 | NA | 4.66E-11 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222439621 | NA | 1.12E-36 | mr1075_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222439621 | 4.64E-06 | 1.70E-07 | mr1129_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222439621 | NA | 9.49E-07 | mr1257_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222439621 | NA | 2.88E-09 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222439621 | NA | 2.87E-10 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222439621 | NA | 2.46E-08 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |