Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222406943:

Variant ID: vg0222406943 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 22406943
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTTAATATTTGTATTAAAATTATTTTGAATAATTTGGATAATATTTGAATATTATATATTTTTAATAATATTGTAAACGTGCGCACAGTCATCTTTAT[G/A]
AACGCACAACATGCACATTGTACCCTCTTAATAATCTGTTAGACATTTTTCTAGACAAACGAAGTCTACTTTCTTTTTAGAGATGACGAAGAAGATAGTA

Reverse complement sequence

TACTATCTTCTTCGTCATCTCTAAAAAGAAAGTAGACTTCGTTTGTCTAGAAAAATGTCTAACAGATTATTAAGAGGGTACAATGTGCATGTTGTGCGTT[C/T]
ATAAAGATGACTGTGCGCACGTTTACAATATTATTAAAAATATATAATATTCAAATATTATCCAAATTATTCAAAATAATTTTAATACAAATATTAAAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.40%	11.80%	3.85%	0.00%	NA
All Indica	2759	73.60%	19.90%	6.45%	0.00%	NA
All Japonica	1512	99.70%	0.20%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	51.10%	32.40%	16.47%	0.00%	NA
Indica II	465	73.30%	18.90%	7.74%	0.00%	NA
Indica III	913	90.30%	9.10%	0.66%	0.00%	NA
Indica Intermediate	786	71.60%	23.50%	4.83%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.20%	0.40%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	5.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222406943	G -> A	LOC_Os02g37070.1	downstream_gene_variant ; 4850.0bp to feature; MODIFIER	silent_mutation	Average:48.083; most accessible tissue: Callus, score: 84.15	N	N	N	N
vg0222406943	G -> A	LOC_Os02g37080.1	downstream_gene_variant ; 760.0bp to feature; MODIFIER	silent_mutation	Average:48.083; most accessible tissue: Callus, score: 84.15	N	N	N	N
vg0222406943	G -> A	LOC_Os02g37080.2	downstream_gene_variant ; 760.0bp to feature; MODIFIER	silent_mutation	Average:48.083; most accessible tissue: Callus, score: 84.15	N	N	N	N
vg0222406943	G -> A	LOC_Os02g37070-LOC_Os02g37080	intergenic_region ; MODIFIER	silent_mutation	Average:48.083; most accessible tissue: Callus, score: 84.15	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222406943	NA	5.00E-06	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943	1.50E-06	NA	mr1069	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943	NA	3.44E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943	NA	4.63E-06	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943	NA	3.11E-06	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943	NA	1.88E-06	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943	NA	5.93E-07	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943	NA	1.84E-06	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943	NA	3.25E-07	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943	NA	1.29E-08	mr1074_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943	NA	4.33E-08	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943	NA	2.07E-06	mr1148_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943	NA	3.87E-10	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943	NA	7.16E-07	mr1222_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943	NA	7.02E-06	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943	NA	4.93E-07	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943	NA	4.38E-06	mr1913_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251