\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222406943:

Variant ID: vg0222406943 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22406943
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTTAATATTTGTATTAAAATTATTTTGAATAATTTGGATAATATTTGAATATTATATATTTTTAATAATATTGTAAACGTGCGCACAGTCATCTTTAT[G/A]
AACGCACAACATGCACATTGTACCCTCTTAATAATCTGTTAGACATTTTTCTAGACAAACGAAGTCTACTTTCTTTTTAGAGATGACGAAGAAGATAGTA

Reverse complement sequence

TACTATCTTCTTCGTCATCTCTAAAAAGAAAGTAGACTTCGTTTGTCTAGAAAAATGTCTAACAGATTATTAAGAGGGTACAATGTGCATGTTGTGCGTT[C/T]
ATAAAGATGACTGTGCGCACGTTTACAATATTATTAAAAATATATAATATTCAAATATTATCCAAATTATTCAAAATAATTTTAATACAAATATTAAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.40% 11.80% 3.85% 0.00% NA
All Indica  2759 73.60% 19.90% 6.45% 0.00% NA
All Japonica  1512 99.70% 0.20% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 51.10% 32.40% 16.47% 0.00% NA
Indica II  465 73.30% 18.90% 7.74% 0.00% NA
Indica III  913 90.30% 9.10% 0.66% 0.00% NA
Indica Intermediate  786 71.60% 23.50% 4.83% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.20% 0.40% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 5.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222406943 G -> A LOC_Os02g37070.1 downstream_gene_variant ; 4850.0bp to feature; MODIFIER silent_mutation Average:48.083; most accessible tissue: Callus, score: 84.15 N N N N
vg0222406943 G -> A LOC_Os02g37080.1 downstream_gene_variant ; 760.0bp to feature; MODIFIER silent_mutation Average:48.083; most accessible tissue: Callus, score: 84.15 N N N N
vg0222406943 G -> A LOC_Os02g37080.2 downstream_gene_variant ; 760.0bp to feature; MODIFIER silent_mutation Average:48.083; most accessible tissue: Callus, score: 84.15 N N N N
vg0222406943 G -> A LOC_Os02g37070-LOC_Os02g37080 intergenic_region ; MODIFIER silent_mutation Average:48.083; most accessible tissue: Callus, score: 84.15 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222406943 NA 5.00E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943 1.50E-06 NA mr1069 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943 NA 3.44E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943 NA 4.63E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943 NA 3.11E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943 NA 1.88E-06 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943 NA 5.93E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943 NA 1.84E-06 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943 NA 3.25E-07 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943 NA 1.29E-08 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943 NA 4.33E-08 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943 NA 2.07E-06 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943 NA 3.87E-10 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943 NA 7.16E-07 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943 NA 7.02E-06 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943 NA 4.93E-07 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222406943 NA 4.38E-06 mr1913_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251