\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222398309:

Variant ID: vg0222398309 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22398309
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTTAGTTATCTAAACAACTATATATCTAAATTTATAACTAAAAGTTGCTTATAATATTATAGGACGGCAGTAATACTACCAACAAAAGCACCCATGCG[C/T]
TAGTCTATGACTAGGGATCATCGGTTGGCCTAATAAGCCAAAGCCAAATTTAAATTTTTTATCTTAATTTTGAAGCTAATTTTAAGATATTTTTAATTTT

Reverse complement sequence

AAAATTAAAAATATCTTAAAATTAGCTTCAAAATTAAGATAAAAAATTTAAATTTGGCTTTGGCTTATTAGGCCAACCGATGATCCCTAGTCATAGACTA[G/A]
CGCATGGGTGCTTTTGTTGGTAGTATTACTGCCGTCCTATAATATTATAAGCAACTTTTAGTTATAAATTTAGATATATAGTTGTTTAGATAACTAAAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.90% 15.90% 0.15% 0.00% NA
All Indica  2759 80.40% 19.40% 0.25% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 30.90% 69.10% 0.00% 0.00% NA
Indica I  595 96.00% 3.90% 0.17% 0.00% NA
Indica II  465 91.60% 8.00% 0.43% 0.00% NA
Indica III  913 63.40% 36.40% 0.22% 0.00% NA
Indica Intermediate  786 81.70% 18.10% 0.25% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222398309 C -> T LOC_Os02g37070.1 upstream_gene_variant ; 3025.0bp to feature; MODIFIER silent_mutation Average:38.379; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0222398309 C -> T LOC_Os02g37060-LOC_Os02g37070 intergenic_region ; MODIFIER silent_mutation Average:38.379; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222398309 NA 5.94E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222398309 3.04E-06 NA mr1098 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222398309 1.40E-06 3.70E-06 mr1098 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222398309 6.24E-06 NA mr1099 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222398309 7.52E-07 NA mr1101 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222398309 NA 6.47E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222398309 NA 3.85E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222398309 NA 2.02E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222398309 NA 5.08E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222398309 2.63E-07 6.58E-22 mr1589 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222398309 1.01E-06 NA mr1589 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222398309 NA 3.37E-06 mr1404_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251