Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222340888:

Variant ID: vg0222340888 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 22340888
Reference Allele: A	Alternative Allele: AT,T,ATT
Primary Allele: A	Secondary Allele: AT

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

GCACGTTGAGGTTATTAAGAAGGATAGGCAGACCTCTAAGTCGAACTGTCAAAGTAGTCATAAGTAAAAGCAAAATACTGTTACTTCTTCTAGACAAAGT[A/AT,T,ATT]
TTTTTTTTATTCAGGCTTCTACACAAGGAATGCACTTTACCATCCATTATTACATTGTTTTAGCCATATGTTGACGACCAATGCTAACAAATAGCACTCA

Reverse complement sequence

TGAGTGCTATTTGTTAGCATTGGTCGTCAACATATGGCTAAAACAATGTAATAATGGATGGTAAAGTGCATTCCTTGTGTAGAAGCCTGAATAAAAAAAA[T/AT,A,AAT]
ACTTTGTCTAGAAGAAGTAACAGTATTTTGCTTTTACTTATGACTACTTTGACAGTTCGACTTAGAGGTCTGCCTATCCTTCTTAATAACCTCAACGTGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of AT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.70%	39.70%	1.82%	0.00%	T: 7.81%; ATT: 0.04%
All Indica	2759	36.30%	61.90%	0.65%	0.00%	T: 1.01%; ATT: 0.07%
All Japonica	1512	72.50%	3.40%	4.23%	0.00%	T: 19.84%
Aus	269	74.70%	25.30%	0.00%	0.00%	NA
Indica I	595	21.00%	75.50%	2.02%	0.00%	T: 1.18%; ATT: 0.34%
Indica II	465	26.20%	73.80%	0.00%	0.00%	NA
Indica III	913	52.20%	47.30%	0.22%	0.00%	T: 0.22%
Indica Intermediate	786	35.40%	61.70%	0.51%	0.00%	T: 2.42%
Temperate Japonica	767	74.10%	0.70%	6.13%	0.00%	T: 19.17%
Tropical Japonica	504	70.80%	9.10%	0.79%	0.00%	T: 19.25%
Japonica Intermediate	241	71.00%	0.40%	5.39%	0.00%	T: 23.24%
VI/Aromatic	96	43.80%	19.80%	3.12%	0.00%	T: 33.33%
Intermediate	90	60.00%	28.90%	1.11%	0.00%	T: 10.00%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222340888	A -> ATT	LOC_Os02g36974.1	downstream_gene_variant ; 3176.0bp to feature; MODIFIER	silent_mutation	Average:40.048; most accessible tissue: Callus, score: 59.252	N	N	N	N
vg0222340888	A -> ATT	LOC_Os02g36974.5	downstream_gene_variant ; 4249.0bp to feature; MODIFIER	silent_mutation	Average:40.048; most accessible tissue: Callus, score: 59.252	N	N	N	N
vg0222340888	A -> ATT	LOC_Os02g36974.2	downstream_gene_variant ; 3176.0bp to feature; MODIFIER	silent_mutation	Average:40.048; most accessible tissue: Callus, score: 59.252	N	N	N	N
vg0222340888	A -> ATT	LOC_Os02g36974.6	downstream_gene_variant ; 3176.0bp to feature; MODIFIER	silent_mutation	Average:40.048; most accessible tissue: Callus, score: 59.252	N	N	N	N
vg0222340888	A -> ATT	LOC_Os02g36974.3	downstream_gene_variant ; 3176.0bp to feature; MODIFIER	silent_mutation	Average:40.048; most accessible tissue: Callus, score: 59.252	N	N	N	N
vg0222340888	A -> ATT	LOC_Os02g36974.4	downstream_gene_variant ; 3176.0bp to feature; MODIFIER	silent_mutation	Average:40.048; most accessible tissue: Callus, score: 59.252	N	N	N	N
vg0222340888	A -> ATT	LOC_Os02g36990.1	intron_variant ; MODIFIER	silent_mutation	Average:40.048; most accessible tissue: Callus, score: 59.252	N	N	N	N
vg0222340888	A -> T	LOC_Os02g36974.1	downstream_gene_variant ; 3175.0bp to feature; MODIFIER	silent_mutation	Average:40.048; most accessible tissue: Callus, score: 59.252	N	N	N	N
vg0222340888	A -> T	LOC_Os02g36974.5	downstream_gene_variant ; 4248.0bp to feature; MODIFIER	silent_mutation	Average:40.048; most accessible tissue: Callus, score: 59.252	N	N	N	N
vg0222340888	A -> T	LOC_Os02g36974.2	downstream_gene_variant ; 3175.0bp to feature; MODIFIER	silent_mutation	Average:40.048; most accessible tissue: Callus, score: 59.252	N	N	N	N
vg0222340888	A -> T	LOC_Os02g36974.6	downstream_gene_variant ; 3175.0bp to feature; MODIFIER	silent_mutation	Average:40.048; most accessible tissue: Callus, score: 59.252	N	N	N	N
vg0222340888	A -> T	LOC_Os02g36974.3	downstream_gene_variant ; 3175.0bp to feature; MODIFIER	silent_mutation	Average:40.048; most accessible tissue: Callus, score: 59.252	N	N	N	N
vg0222340888	A -> T	LOC_Os02g36974.4	downstream_gene_variant ; 3175.0bp to feature; MODIFIER	silent_mutation	Average:40.048; most accessible tissue: Callus, score: 59.252	N	N	N	N
vg0222340888	A -> T	LOC_Os02g36990.1	intron_variant ; MODIFIER	silent_mutation	Average:40.048; most accessible tissue: Callus, score: 59.252	N	N	N	N
vg0222340888	A -> AT	LOC_Os02g36974.1	downstream_gene_variant ; 3176.0bp to feature; MODIFIER	silent_mutation	Average:40.048; most accessible tissue: Callus, score: 59.252	N	N	N	N
vg0222340888	A -> AT	LOC_Os02g36974.5	downstream_gene_variant ; 4249.0bp to feature; MODIFIER	silent_mutation	Average:40.048; most accessible tissue: Callus, score: 59.252	N	N	N	N
vg0222340888	A -> AT	LOC_Os02g36974.2	downstream_gene_variant ; 3176.0bp to feature; MODIFIER	silent_mutation	Average:40.048; most accessible tissue: Callus, score: 59.252	N	N	N	N
vg0222340888	A -> AT	LOC_Os02g36974.6	downstream_gene_variant ; 3176.0bp to feature; MODIFIER	silent_mutation	Average:40.048; most accessible tissue: Callus, score: 59.252	N	N	N	N
vg0222340888	A -> AT	LOC_Os02g36974.3	downstream_gene_variant ; 3176.0bp to feature; MODIFIER	silent_mutation	Average:40.048; most accessible tissue: Callus, score: 59.252	N	N	N	N
vg0222340888	A -> AT	LOC_Os02g36974.4	downstream_gene_variant ; 3176.0bp to feature; MODIFIER	silent_mutation	Average:40.048; most accessible tissue: Callus, score: 59.252	N	N	N	N
vg0222340888	A -> AT	LOC_Os02g36990.1	intron_variant ; MODIFIER	silent_mutation	Average:40.048; most accessible tissue: Callus, score: 59.252	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222340888	1.78E-06	NA	mr1680_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251