\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222340888:

Variant ID: vg0222340888 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 22340888
Reference Allele: AAlternative Allele: AT,T,ATT
Primary Allele: ASecondary Allele: AT

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


GCACGTTGAGGTTATTAAGAAGGATAGGCAGACCTCTAAGTCGAACTGTCAAAGTAGTCATAAGTAAAAGCAAAATACTGTTACTTCTTCTAGACAAAGT[A/AT,T,ATT]
TTTTTTTTATTCAGGCTTCTACACAAGGAATGCACTTTACCATCCATTATTACATTGTTTTAGCCATATGTTGACGACCAATGCTAACAAATAGCACTCA

Reverse complement sequence

TGAGTGCTATTTGTTAGCATTGGTCGTCAACATATGGCTAAAACAATGTAATAATGGATGGTAAAGTGCATTCCTTGTGTAGAAGCCTGAATAAAAAAAA[T/AT,A,AAT]
ACTTTGTCTAGAAGAAGTAACAGTATTTTGCTTTTACTTATGACTACTTTGACAGTTCGACTTAGAGGTCTGCCTATCCTTCTTAATAACCTCAACGTGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of AT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.70% 39.70% 1.82% 0.00% T: 7.81%; ATT: 0.04%
All Indica  2759 36.30% 61.90% 0.65% 0.00% T: 1.01%; ATT: 0.07%
All Japonica  1512 72.50% 3.40% 4.23% 0.00% T: 19.84%
Aus  269 74.70% 25.30% 0.00% 0.00% NA
Indica I  595 21.00% 75.50% 2.02% 0.00% T: 1.18%; ATT: 0.34%
Indica II  465 26.20% 73.80% 0.00% 0.00% NA
Indica III  913 52.20% 47.30% 0.22% 0.00% T: 0.22%
Indica Intermediate  786 35.40% 61.70% 0.51% 0.00% T: 2.42%
Temperate Japonica  767 74.10% 0.70% 6.13% 0.00% T: 19.17%
Tropical Japonica  504 70.80% 9.10% 0.79% 0.00% T: 19.25%
Japonica Intermediate  241 71.00% 0.40% 5.39% 0.00% T: 23.24%
VI/Aromatic  96 43.80% 19.80% 3.12% 0.00% T: 33.33%
Intermediate  90 60.00% 28.90% 1.11% 0.00% T: 10.00%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222340888 A -> ATT LOC_Os02g36974.1 downstream_gene_variant ; 3176.0bp to feature; MODIFIER silent_mutation Average:40.048; most accessible tissue: Callus, score: 59.252 N N N N
vg0222340888 A -> ATT LOC_Os02g36974.5 downstream_gene_variant ; 4249.0bp to feature; MODIFIER silent_mutation Average:40.048; most accessible tissue: Callus, score: 59.252 N N N N
vg0222340888 A -> ATT LOC_Os02g36974.2 downstream_gene_variant ; 3176.0bp to feature; MODIFIER silent_mutation Average:40.048; most accessible tissue: Callus, score: 59.252 N N N N
vg0222340888 A -> ATT LOC_Os02g36974.6 downstream_gene_variant ; 3176.0bp to feature; MODIFIER silent_mutation Average:40.048; most accessible tissue: Callus, score: 59.252 N N N N
vg0222340888 A -> ATT LOC_Os02g36974.3 downstream_gene_variant ; 3176.0bp to feature; MODIFIER silent_mutation Average:40.048; most accessible tissue: Callus, score: 59.252 N N N N
vg0222340888 A -> ATT LOC_Os02g36974.4 downstream_gene_variant ; 3176.0bp to feature; MODIFIER silent_mutation Average:40.048; most accessible tissue: Callus, score: 59.252 N N N N
vg0222340888 A -> ATT LOC_Os02g36990.1 intron_variant ; MODIFIER silent_mutation Average:40.048; most accessible tissue: Callus, score: 59.252 N N N N
vg0222340888 A -> T LOC_Os02g36974.1 downstream_gene_variant ; 3175.0bp to feature; MODIFIER silent_mutation Average:40.048; most accessible tissue: Callus, score: 59.252 N N N N
vg0222340888 A -> T LOC_Os02g36974.5 downstream_gene_variant ; 4248.0bp to feature; MODIFIER silent_mutation Average:40.048; most accessible tissue: Callus, score: 59.252 N N N N
vg0222340888 A -> T LOC_Os02g36974.2 downstream_gene_variant ; 3175.0bp to feature; MODIFIER silent_mutation Average:40.048; most accessible tissue: Callus, score: 59.252 N N N N
vg0222340888 A -> T LOC_Os02g36974.6 downstream_gene_variant ; 3175.0bp to feature; MODIFIER silent_mutation Average:40.048; most accessible tissue: Callus, score: 59.252 N N N N
vg0222340888 A -> T LOC_Os02g36974.3 downstream_gene_variant ; 3175.0bp to feature; MODIFIER silent_mutation Average:40.048; most accessible tissue: Callus, score: 59.252 N N N N
vg0222340888 A -> T LOC_Os02g36974.4 downstream_gene_variant ; 3175.0bp to feature; MODIFIER silent_mutation Average:40.048; most accessible tissue: Callus, score: 59.252 N N N N
vg0222340888 A -> T LOC_Os02g36990.1 intron_variant ; MODIFIER silent_mutation Average:40.048; most accessible tissue: Callus, score: 59.252 N N N N
vg0222340888 A -> AT LOC_Os02g36974.1 downstream_gene_variant ; 3176.0bp to feature; MODIFIER silent_mutation Average:40.048; most accessible tissue: Callus, score: 59.252 N N N N
vg0222340888 A -> AT LOC_Os02g36974.5 downstream_gene_variant ; 4249.0bp to feature; MODIFIER silent_mutation Average:40.048; most accessible tissue: Callus, score: 59.252 N N N N
vg0222340888 A -> AT LOC_Os02g36974.2 downstream_gene_variant ; 3176.0bp to feature; MODIFIER silent_mutation Average:40.048; most accessible tissue: Callus, score: 59.252 N N N N
vg0222340888 A -> AT LOC_Os02g36974.6 downstream_gene_variant ; 3176.0bp to feature; MODIFIER silent_mutation Average:40.048; most accessible tissue: Callus, score: 59.252 N N N N
vg0222340888 A -> AT LOC_Os02g36974.3 downstream_gene_variant ; 3176.0bp to feature; MODIFIER silent_mutation Average:40.048; most accessible tissue: Callus, score: 59.252 N N N N
vg0222340888 A -> AT LOC_Os02g36974.4 downstream_gene_variant ; 3176.0bp to feature; MODIFIER silent_mutation Average:40.048; most accessible tissue: Callus, score: 59.252 N N N N
vg0222340888 A -> AT LOC_Os02g36990.1 intron_variant ; MODIFIER silent_mutation Average:40.048; most accessible tissue: Callus, score: 59.252 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222340888 1.78E-06 NA mr1680_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251