Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0222329370:

Variant ID: vg0222329370 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 22329370
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:

CCTCATCACATCAGGAAGTTCCCATACCATTCTTACTGCCTTCTGCAATACAAGCATTGTGAAGGGGAACCTAGCAAAAACCAACCCAATTAATGCCATT[G/T]
GAGATAAACGGGGTATGTATTTTTGCAGCAAATATAATGTTTATGAGAATAGAAGGGGTTATTTCTCATGATTTTAGCATAGAATGGAAGGAACAATTTT

Reverse complement sequence

AAAATTGTTCCTTCCATTCTATGCTAAAATCATGAGAAATAACCCCTTCTATTCTCATAAACATTATATTTGCTGCAAAAATACATACCCCGTTTATCTC[C/A]
AATGGCATTAATTGGGTTGGTTTTTGCTAGGTTCCCCTTCACAATGCTTGTATTGCAGAAGGCAGTAAGAATGGTATGGGAACTTCCTGATGTGATGAGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.90%	1.70%	0.32%	0.00%	NA
All Indica	2759	99.90%	0.00%	0.07%	0.00%	NA
All Japonica	1512	94.00%	5.20%	0.79%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.10%	0.25%	0.00%	NA
Temperate Japonica	767	99.10%	0.70%	0.26%	0.00%	NA
Tropical Japonica	504	89.70%	8.90%	1.39%	0.00%	NA
Japonica Intermediate	241	86.70%	12.00%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	2.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222329370	G -> T	LOC_Os02g36974.1	upstream_gene_variant ; 3911.0bp to feature; MODIFIER	silent_mutation	Average:52.148; most accessible tissue: Zhenshan97 young leaf, score: 71.065	N	N	N	N
vg0222329370	G -> T	LOC_Os02g36974.5	upstream_gene_variant ; 3911.0bp to feature; MODIFIER	silent_mutation	Average:52.148; most accessible tissue: Zhenshan97 young leaf, score: 71.065	N	N	N	N
vg0222329370	G -> T	LOC_Os02g36974.2	upstream_gene_variant ; 3911.0bp to feature; MODIFIER	silent_mutation	Average:52.148; most accessible tissue: Zhenshan97 young leaf, score: 71.065	N	N	N	N
vg0222329370	G -> T	LOC_Os02g36974.6	upstream_gene_variant ; 3911.0bp to feature; MODIFIER	silent_mutation	Average:52.148; most accessible tissue: Zhenshan97 young leaf, score: 71.065	N	N	N	N
vg0222329370	G -> T	LOC_Os02g36974.3	upstream_gene_variant ; 3946.0bp to feature; MODIFIER	silent_mutation	Average:52.148; most accessible tissue: Zhenshan97 young leaf, score: 71.065	N	N	N	N
vg0222329370	G -> T	LOC_Os02g36960.1	intron_variant ; MODIFIER	silent_mutation	Average:52.148; most accessible tissue: Zhenshan97 young leaf, score: 71.065	N	N	N	N
vg0222329370	G -> T	LOC_Os02g36960.2	intron_variant ; MODIFIER	silent_mutation	Average:52.148; most accessible tissue: Zhenshan97 young leaf, score: 71.065	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222329370	4.65E-06	1.35E-07	mr1228_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222329370	NA	9.65E-06	mr1232_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222329370	NA	3.68E-07	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222329370	NA	5.37E-06	mr1557_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222329370	NA	1.40E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222329370	NA	6.85E-07	mr1944_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251