\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222329370:

Variant ID: vg0222329370 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22329370
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:


CCTCATCACATCAGGAAGTTCCCATACCATTCTTACTGCCTTCTGCAATACAAGCATTGTGAAGGGGAACCTAGCAAAAACCAACCCAATTAATGCCATT[G/T]
GAGATAAACGGGGTATGTATTTTTGCAGCAAATATAATGTTTATGAGAATAGAAGGGGTTATTTCTCATGATTTTAGCATAGAATGGAAGGAACAATTTT

Reverse complement sequence

AAAATTGTTCCTTCCATTCTATGCTAAAATCATGAGAAATAACCCCTTCTATTCTCATAAACATTATATTTGCTGCAAAAATACATACCCCGTTTATCTC[C/A]
AATGGCATTAATTGGGTTGGTTTTTGCTAGGTTCCCCTTCACAATGCTTGTATTGCAGAAGGCAGTAAGAATGGTATGGGAACTTCCTGATGTGATGAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.90% 1.70% 0.32% 0.00% NA
All Indica  2759 99.90% 0.00% 0.07% 0.00% NA
All Japonica  1512 94.00% 5.20% 0.79% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.10% 0.25% 0.00% NA
Temperate Japonica  767 99.10% 0.70% 0.26% 0.00% NA
Tropical Japonica  504 89.70% 8.90% 1.39% 0.00% NA
Japonica Intermediate  241 86.70% 12.00% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222329370 G -> T LOC_Os02g36974.1 upstream_gene_variant ; 3911.0bp to feature; MODIFIER silent_mutation Average:52.148; most accessible tissue: Zhenshan97 young leaf, score: 71.065 N N N N
vg0222329370 G -> T LOC_Os02g36974.5 upstream_gene_variant ; 3911.0bp to feature; MODIFIER silent_mutation Average:52.148; most accessible tissue: Zhenshan97 young leaf, score: 71.065 N N N N
vg0222329370 G -> T LOC_Os02g36974.2 upstream_gene_variant ; 3911.0bp to feature; MODIFIER silent_mutation Average:52.148; most accessible tissue: Zhenshan97 young leaf, score: 71.065 N N N N
vg0222329370 G -> T LOC_Os02g36974.6 upstream_gene_variant ; 3911.0bp to feature; MODIFIER silent_mutation Average:52.148; most accessible tissue: Zhenshan97 young leaf, score: 71.065 N N N N
vg0222329370 G -> T LOC_Os02g36974.3 upstream_gene_variant ; 3946.0bp to feature; MODIFIER silent_mutation Average:52.148; most accessible tissue: Zhenshan97 young leaf, score: 71.065 N N N N
vg0222329370 G -> T LOC_Os02g36960.1 intron_variant ; MODIFIER silent_mutation Average:52.148; most accessible tissue: Zhenshan97 young leaf, score: 71.065 N N N N
vg0222329370 G -> T LOC_Os02g36960.2 intron_variant ; MODIFIER silent_mutation Average:52.148; most accessible tissue: Zhenshan97 young leaf, score: 71.065 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222329370 4.65E-06 1.35E-07 mr1228_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222329370 NA 9.65E-06 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222329370 NA 3.68E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222329370 NA 5.37E-06 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222329370 NA 1.40E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222329370 NA 6.85E-07 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251