\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222314975:

Variant ID: vg0222314975 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22314975
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, T: 0.31, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


GTCGGATGGAGGAGGTGAAAGGCACGGATCTTCACATGTGCTGACACTTGTCCCGGCGAGGAAACGGGTTAGAGCAAGTACAATAGCAGCCTATAAGCCA[A/T]
CTATAACCACATATCGAGAAGAAAAGAGAAGAGAGAGAAGAAAGCGGGCTACAGATTTGTAGTCAGCTGCAACATGGACTCCAAGACGTTTTGTGTGTAT

Reverse complement sequence

ATACACACAAAACGTCTTGGAGTCCATGTTGCAGCTGACTACAAATCTGTAGCCCGCTTTCTTCTCTCTCTTCTCTTTTCTTCTCGATATGTGGTTATAG[T/A]
TGGCTTATAGGCTGCTATTGTACTTGCTCTAACCCGTTTCCTCGCCGGGACAAGTGTCAGCACATGTGAAGATCCGTGCCTTTCACCTCCTCCATCCGAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.50% 38.40% 0.04% 0.00% NA
All Indica  2759 90.30% 9.70% 0.00% 0.00% NA
All Japonica  1512 4.80% 95.10% 0.07% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 84.90% 15.10% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 90.30% 9.70% 0.00% 0.00% NA
Indica Intermediate  786 88.90% 11.10% 0.00% 0.00% NA
Temperate Japonica  767 1.40% 98.40% 0.13% 0.00% NA
Tropical Japonica  504 10.70% 89.30% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 35.40% 64.60% 0.00% 0.00% NA
Intermediate  90 47.80% 51.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222314975 A -> T LOC_Os02g36940.1 upstream_gene_variant ; 1813.0bp to feature; MODIFIER silent_mutation Average:69.08; most accessible tissue: Zhenshan97 young leaf, score: 78.347 N N N N
vg0222314975 A -> T LOC_Os02g36950.1 downstream_gene_variant ; 4880.0bp to feature; MODIFIER silent_mutation Average:69.08; most accessible tissue: Zhenshan97 young leaf, score: 78.347 N N N N
vg0222314975 A -> T LOC_Os02g36950.2 downstream_gene_variant ; 4880.0bp to feature; MODIFIER silent_mutation Average:69.08; most accessible tissue: Zhenshan97 young leaf, score: 78.347 N N N N
vg0222314975 A -> T LOC_Os02g36940-LOC_Os02g36950 intergenic_region ; MODIFIER silent_mutation Average:69.08; most accessible tissue: Zhenshan97 young leaf, score: 78.347 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222314975 NA 2.13E-15 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975 6.96E-06 2.78E-23 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975 NA 2.18E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975 2.15E-06 NA mr1224 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975 NA 9.52E-06 mr1913 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975 5.93E-06 NA mr1918 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975 5.27E-06 NA mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975 1.78E-06 NA mr1124_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975 NA 7.34E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975 NA 3.60E-11 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975 NA 1.80E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975 9.64E-07 NA mr1911_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975 NA 1.71E-06 mr1911_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975 1.81E-06 NA mr1918_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975 5.97E-07 4.92E-07 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975 9.32E-06 NA mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975 2.94E-07 NA mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251