Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222314975:

Variant ID: vg0222314975 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 22314975
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, T: 0.31, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

GTCGGATGGAGGAGGTGAAAGGCACGGATCTTCACATGTGCTGACACTTGTCCCGGCGAGGAAACGGGTTAGAGCAAGTACAATAGCAGCCTATAAGCCA[A/T]
CTATAACCACATATCGAGAAGAAAAGAGAAGAGAGAGAAGAAAGCGGGCTACAGATTTGTAGTCAGCTGCAACATGGACTCCAAGACGTTTTGTGTGTAT

Reverse complement sequence

ATACACACAAAACGTCTTGGAGTCCATGTTGCAGCTGACTACAAATCTGTAGCCCGCTTTCTTCTCTCTCTTCTCTTTTCTTCTCGATATGTGGTTATAG[T/A]
TGGCTTATAGGCTGCTATTGTACTTGCTCTAACCCGTTTCCTCGCCGGGACAAGTGTCAGCACATGTGAAGATCCGTGCCTTTCACCTCCTCCATCCGAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.50%	38.40%	0.04%	0.00%	NA
All Indica	2759	90.30%	9.70%	0.00%	0.00%	NA
All Japonica	1512	4.80%	95.10%	0.07%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	84.90%	15.10%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	90.30%	9.70%	0.00%	0.00%	NA
Indica Intermediate	786	88.90%	11.10%	0.00%	0.00%	NA
Temperate Japonica	767	1.40%	98.40%	0.13%	0.00%	NA
Tropical Japonica	504	10.70%	89.30%	0.00%	0.00%	NA
Japonica Intermediate	241	3.30%	96.70%	0.00%	0.00%	NA
VI/Aromatic	96	35.40%	64.60%	0.00%	0.00%	NA
Intermediate	90	47.80%	51.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222314975	A -> T	LOC_Os02g36940.1	upstream_gene_variant ; 1813.0bp to feature; MODIFIER	silent_mutation	Average:69.08; most accessible tissue: Zhenshan97 young leaf, score: 78.347	N	N	N	N
vg0222314975	A -> T	LOC_Os02g36950.1	downstream_gene_variant ; 4880.0bp to feature; MODIFIER	silent_mutation	Average:69.08; most accessible tissue: Zhenshan97 young leaf, score: 78.347	N	N	N	N
vg0222314975	A -> T	LOC_Os02g36950.2	downstream_gene_variant ; 4880.0bp to feature; MODIFIER	silent_mutation	Average:69.08; most accessible tissue: Zhenshan97 young leaf, score: 78.347	N	N	N	N
vg0222314975	A -> T	LOC_Os02g36940-LOC_Os02g36950	intergenic_region ; MODIFIER	silent_mutation	Average:69.08; most accessible tissue: Zhenshan97 young leaf, score: 78.347	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222314975	NA	2.13E-15	mr1146	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975	6.96E-06	2.78E-23	mr1150	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975	NA	2.18E-08	mr1222	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975	2.15E-06	NA	mr1224	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975	NA	9.52E-06	mr1913	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975	5.93E-06	NA	mr1918	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975	5.27E-06	NA	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975	1.78E-06	NA	mr1124_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975	NA	7.34E-09	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975	NA	3.60E-11	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975	NA	1.80E-09	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975	9.64E-07	NA	mr1911_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975	NA	1.71E-06	mr1911_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975	1.81E-06	NA	mr1918_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975	5.97E-07	4.92E-07	mr1918_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975	9.32E-06	NA	mr1929_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222314975	2.94E-07	NA	mr1962_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251