\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222276877:

Variant ID: vg0222276877 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22276877
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGGCTTAACAAATAAAATTCAATATATATAAGTGACCAAACTTTCCTCCCTCTGTACCATTTGGGAACTATCTACAAACTTTTATATGCATGAACATGT[C/T]
TACAAACTATCTACAAACTTTTATATGCTCGTGCGATCGTGCCACTTCTTCATTCGTTTGGCGGCCAATTTTTAACATATCCATATGACTTTCTTGGCGT

Reverse complement sequence

ACGCCAAGAAAGTCATATGGATATGTTAAAAATTGGCCGCCAAACGAATGAAGAAGTGGCACGATCGCACGAGCATATAAAAGTTTGTAGATAGTTTGTA[G/A]
ACATGTTCATGCATATAAAAGTTTGTAGATAGTTCCCAAATGGTACAGAGGGAGGAAAGTTTGGTCACTTATATATATTGAATTTTATTTGTTAAGCCAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.10% 33.30% 2.60% 0.00% NA
All Indica  2759 89.60% 6.80% 3.55% 0.00% NA
All Japonica  1512 15.10% 84.70% 0.20% 0.00% NA
Aus  269 93.30% 0.00% 6.69% 0.00% NA
Indica I  595 80.80% 15.10% 4.03% 0.00% NA
Indica II  465 95.30% 0.40% 4.30% 0.00% NA
Indica III  913 94.60% 2.60% 2.74% 0.00% NA
Indica Intermediate  786 87.20% 9.20% 3.69% 0.00% NA
Temperate Japonica  767 19.40% 80.40% 0.13% 0.00% NA
Tropical Japonica  504 10.30% 89.30% 0.40% 0.00% NA
Japonica Intermediate  241 11.60% 88.40% 0.00% 0.00% NA
VI/Aromatic  96 33.30% 64.60% 2.08% 0.00% NA
Intermediate  90 51.10% 46.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222276877 C -> T LOC_Os02g36890-LOC_Os02g36910 intergenic_region ; MODIFIER silent_mutation Average:36.012; most accessible tissue: Minghui63 root, score: 86.705 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0222276877 C T -0.08 -0.02 -0.02 -0.03 -0.04 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222276877 NA 1.48E-06 Awn_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0222276877 7.38E-07 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222276877 2.43E-06 NA mr1087_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222276877 NA 5.53E-06 mr1109_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222276877 NA 1.76E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251