\
| Variant ID: vg0222271516 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22271516 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTCTATAATATACCGACGACTTTATCAATTGTTCTACAATACGCTATTGGGTTGGGCCTTTTTTTTCAAAAATACCTAAAATATCCTTAGAGACATACAA[G/A]
ATTAACAATTGATTTATCTCATTAGAAGTTTCAAAAAAATATGAAAAGTTTTATGTGGCCTTGTTACACAACATGGAAGTTTGTATAATGTTTCAAGTTT
AAACTTGAAACATTATACAAACTTCCATGTTGTGTAACAAGGCCACATAAAACTTTTCATATTTTTTTGAAACTTCTAATGAGATAAATCAATTGTTAAT[C/T]
TTGTATGTCTCTAAGGATATTTTAGGTATTTTTGAAAAAAAAGGCCCAACCCAATAGCGTATTGTAGAACAATTGATAAAGTCGTCGGTATATTATAGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.90% | 2.80% | 3.47% | 6.88% | NA |
| All Indica | 2759 | 80.90% | 2.10% | 5.51% | 11.49% | NA |
| All Japonica | 1512 | 99.30% | 0.10% | 0.26% | 0.33% | NA |
| Aus | 269 | 78.80% | 20.10% | 1.12% | 0.00% | NA |
| Indica I | 595 | 78.80% | 0.70% | 9.41% | 11.09% | NA |
| Indica II | 465 | 63.70% | 1.30% | 7.53% | 27.53% | NA |
| Indica III | 913 | 95.00% | 0.70% | 1.86% | 2.52% | NA |
| Indica Intermediate | 786 | 76.50% | 5.20% | 5.60% | 12.72% | NA |
| Temperate Japonica | 767 | 99.50% | 0.00% | 0.26% | 0.26% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.40% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 0.00% | 5.56% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222271516 | G -> A | LOC_Os02g36890.1 | downstream_gene_variant ; 1274.0bp to feature; MODIFIER | silent_mutation | Average:27.286; most accessible tissue: Callus, score: 66.752 | N | N | N | N |
| vg0222271516 | G -> A | LOC_Os02g36890-LOC_Os02g36910 | intergenic_region ; MODIFIER | silent_mutation | Average:27.286; most accessible tissue: Callus, score: 66.752 | N | N | N | N |
| vg0222271516 | G -> DEL | N | N | silent_mutation | Average:27.286; most accessible tissue: Callus, score: 66.752 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222271516 | 1.82E-07 | NA | mr1098_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222271516 | 1.03E-06 | NA | mr1098_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222271516 | 3.67E-07 | NA | mr1099_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222271516 | 2.23E-07 | NA | mr1099_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222271516 | 1.21E-07 | NA | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222271516 | 2.81E-07 | 1.25E-16 | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222271516 | 8.80E-08 | NA | mr1117_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222271516 | 1.68E-08 | 1.88E-17 | mr1119_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222271516 | 4.11E-07 | NA | mr1120_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222271516 | 1.99E-06 | NA | mr1120_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222271516 | 3.90E-09 | NA | mr1123_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222271516 | 7.05E-08 | 1.00E-06 | mr1123_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222271516 | 2.91E-08 | NA | mr1150_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222271516 | 8.79E-07 | NA | mr1150_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222271516 | 5.60E-09 | NA | mr1240_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222271516 | 6.98E-08 | NA | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222271516 | 7.59E-06 | 1.22E-06 | mr1242_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222271516 | 3.50E-09 | NA | mr1247_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222271516 | 6.78E-08 | 8.08E-06 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222271516 | NA | 2.10E-06 | mr1378_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222271516 | 3.71E-08 | NA | mr1496_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222271516 | 1.34E-06 | NA | mr1936_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222271516 | NA | 2.53E-06 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |