\
| Variant ID: vg0222221610 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22221610 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCAGCCTTATCCTTATCCTCTCCACACAACCGCCTCCTCCTCCTCCTCCTCCTCCTCCTCTCTCTCTCTCTCTCACTGCCTACCTCGCCGTCCTCCTTCC[T/C]
CCTCCCTTTCTCCTCCTTATCTGGCGGTGCCCTCCCCCTCTCTCTCCAAGCACCGATGGAGATCTGGAGGTGGCACAGAGGCCGGTCACTGCGGATGACA
TGTCATCCGCAGTGACCGGCCTCTGTGCCACCTCCAGATCTCCATCGGTGCTTGGAGAGAGAGGGGGAGGGCACCGCCAGATAAGGAGGAGAAAGGGAGG[A/G]
GGAAGGAGGACGGCGAGGTAGGCAGTGAGAGAGAGAGAGAGAGGAGGAGGAGGAGGAGGAGGAGGAGGCGGTTGTGTGGAGAGGATAAGGATAAGGCTGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.70% | 16.20% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 54.20% | 45.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 15.80% | 84.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 83.00% | 16.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222221610 | T -> C | LOC_Os02g36830.1 | downstream_gene_variant ; 3659.0bp to feature; MODIFIER | silent_mutation | Average:65.981; most accessible tissue: Zhenshan97 young leaf, score: 87.299 | N | N | N | N |
| vg0222221610 | T -> C | LOC_Os02g36830-LOC_Os02g36840 | intergenic_region ; MODIFIER | silent_mutation | Average:65.981; most accessible tissue: Zhenshan97 young leaf, score: 87.299 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222221610 | NA | 4.19E-14 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0222221610 | NA | 1.04E-24 | mr1115 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222221610 | NA | 2.85E-32 | mr1137 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222221610 | NA | 3.36E-09 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222221610 | 1.16E-06 | NA | mr1336 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222221610 | 2.16E-06 | NA | mr1579 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222221610 | NA | 1.25E-07 | mr1579 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222221610 | NA | 4.27E-26 | mr1617 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222221610 | NA | 4.79E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222221610 | NA | 4.33E-07 | mr1672 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222221610 | 1.07E-06 | NA | mr1701 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222221610 | 1.87E-06 | 1.87E-06 | mr1701 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222221610 | NA | 4.37E-06 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222221610 | NA | 3.56E-12 | mr1879 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222221610 | NA | 4.18E-06 | mr1672_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222221610 | NA | 2.09E-06 | mr1693_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |