Variant ID: vg0222194170 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 22194170 |
Reference Allele: A | Alternative Allele: G,T,C |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 195. )
TTTATTTCTATCCACACCTAATCTTTATTTTAATTTGTATTTACTCCTAAGCATTTGGGTGACCATATTAAGTGCTCAAATGTGAATTTTCCCAAAATTT[A/G,T,C]
ATATTGTCCAATATTTAATATATATCCTAGATTTTTATAATTCCCTATATTTGGGATTTTGGTATTTATATGTTTTCACATATATTGGTTTATCTTTTTG
CAAAAAGATAAACCAATATATGTGAAAACATATAAATACCAAAATCCCAAATATAGGGAATTATAAAAATCTAGGATATATATTAAATATTGGACAATAT[T/C,A,G]
AAATTTTGGGAAAATTCACATTTGAGCACTTAATATGGTCACCCAAATGCTTAGGAGTAAATACAAATTAAAATAAAGATTAGGTGTGGATAGAAATAAA
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.80% | 0.70% | 1.40% | 1.12% | NA |
All Indica | 2759 | 96.60% | 1.10% | 2.25% | 0.00% | NA |
All Japonica | 1512 | 96.30% | 0.00% | 0.20% | 3.51% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 96.80% | 0.80% | 2.35% | 0.00% | NA |
Indica II | 465 | 97.00% | 0.40% | 2.58% | 0.00% | NA |
Indica III | 913 | 96.50% | 1.50% | 1.97% | 0.00% | NA |
Indica Intermediate | 786 | 96.40% | 1.30% | 2.29% | 0.00% | NA |
Temperate Japonica | 767 | 93.10% | 0.00% | 0.39% | 6.52% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 98.80% | 0.00% | 0.00% | 1.24% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0222194170 | A -> G | LOC_Os02g36790.1 | downstream_gene_variant ; 4876.0bp to feature; MODIFIER | silent_mutation | Average:13.989; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
vg0222194170 | A -> G | LOC_Os02g36800.1 | intron_variant ; MODIFIER | silent_mutation | Average:13.989; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
vg0222194170 | A -> T | LOC_Os02g36790.1 | downstream_gene_variant ; 4876.0bp to feature; MODIFIER | N | Average:13.989; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
vg0222194170 | A -> T | LOC_Os02g36800.1 | intron_variant ; MODIFIER | N | Average:13.989; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
vg0222194170 | A -> DEL | N | N | silent_mutation | Average:13.989; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
vg0222194170 | A -> C | LOC_Os02g36790.1 | downstream_gene_variant ; 4876.0bp to feature; MODIFIER | N | Average:13.989; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
vg0222194170 | A -> C | LOC_Os02g36800.1 | intron_variant ; MODIFIER | N | Average:13.989; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0222194170 | 4.03E-06 | 4.03E-06 | mr1464 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222194170 | 3.88E-06 | 3.88E-06 | mr1469 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222194170 | 5.44E-06 | 3.50E-06 | mr1743 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |