Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222194170:

Variant ID: vg0222194170 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22194170
Reference Allele: AAlternative Allele: G,T,C
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


TTTATTTCTATCCACACCTAATCTTTATTTTAATTTGTATTTACTCCTAAGCATTTGGGTGACCATATTAAGTGCTCAAATGTGAATTTTCCCAAAATTT[A/G,T,C]
ATATTGTCCAATATTTAATATATATCCTAGATTTTTATAATTCCCTATATTTGGGATTTTGGTATTTATATGTTTTCACATATATTGGTTTATCTTTTTG

Reverse complement sequence

CAAAAAGATAAACCAATATATGTGAAAACATATAAATACCAAAATCCCAAATATAGGGAATTATAAAAATCTAGGATATATATTAAATATTGGACAATAT[T/C,A,G]
AAATTTTGGGAAAATTCACATTTGAGCACTTAATATGGTCACCCAAATGCTTAGGAGTAAATACAAATTAAAATAAAGATTAGGTGTGGATAGAAATAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.80% 0.70% 1.40% 1.12% NA
All Indica  2759 96.60% 1.10% 2.25% 0.00% NA
All Japonica  1512 96.30% 0.00% 0.20% 3.51% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.80% 0.80% 2.35% 0.00% NA
Indica II  465 97.00% 0.40% 2.58% 0.00% NA
Indica III  913 96.50% 1.50% 1.97% 0.00% NA
Indica Intermediate  786 96.40% 1.30% 2.29% 0.00% NA
Temperate Japonica  767 93.10% 0.00% 0.39% 6.52% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.00% 0.00% 1.24% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222194170 A -> G LOC_Os02g36790.1 downstream_gene_variant ; 4876.0bp to feature; MODIFIER silent_mutation Average:13.989; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0222194170 A -> G LOC_Os02g36800.1 intron_variant ; MODIFIER silent_mutation Average:13.989; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0222194170 A -> T LOC_Os02g36790.1 downstream_gene_variant ; 4876.0bp to feature; MODIFIER N Average:13.989; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0222194170 A -> T LOC_Os02g36800.1 intron_variant ; MODIFIER N Average:13.989; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0222194170 A -> DEL N N silent_mutation Average:13.989; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0222194170 A -> C LOC_Os02g36790.1 downstream_gene_variant ; 4876.0bp to feature; MODIFIER N Average:13.989; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0222194170 A -> C LOC_Os02g36800.1 intron_variant ; MODIFIER N Average:13.989; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222194170 4.03E-06 4.03E-06 mr1464 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222194170 3.88E-06 3.88E-06 mr1469 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222194170 5.44E-06 3.50E-06 mr1743 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251