\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222163084:

Variant ID: vg0222163084 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22163084
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACACGTTACACACACCCTTTTCATTGACCTCTGATATAAATACTCTATTCGGCTGTGTTCGCATGCAGGGGATTCCCTCCGCACGGAAAACCAAACGGTT[C/T]
ATTAGCACGAAACGGTTCATTAGCGTATGATTAATTAAATATTAGCTAATTTTTTTTAAAAAAATAGCAGTTTAAAAAACATGCACACGGAAAACGAGAG

Reverse complement sequence

CTCTCGTTTTCCGTGTGCATGTTTTTTAAACTGCTATTTTTTTAAAAAAAATTAGCTAATATTTAATTAATCATACGCTAATGAACCGTTTCGTGCTAAT[G/A]
AACCGTTTGGTTTTCCGTGCGGAGGGAATCCCCTGCATGCGAACACAGCCGAATAGAGTATTTATATCAGAGGTCAATGAAAAGGGTGTGTGTAACGTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.30% 1.80% 0.91% 0.00% NA
All Indica  2759 95.60% 2.90% 1.52% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.30% 0.00% 0.67% 0.00% NA
Indica II  465 82.20% 11.40% 6.45% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 95.70% 3.30% 1.02% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222163084 C -> T LOC_Os02g36720.1 upstream_gene_variant ; 4726.0bp to feature; MODIFIER silent_mutation Average:95.027; most accessible tissue: Zhenshan97 panicle, score: 96.953 N N N N
vg0222163084 C -> T LOC_Os02g36730.1 downstream_gene_variant ; 1425.0bp to feature; MODIFIER silent_mutation Average:95.027; most accessible tissue: Zhenshan97 panicle, score: 96.953 N N N N
vg0222163084 C -> T LOC_Os02g36740.1 downstream_gene_variant ; 215.0bp to feature; MODIFIER silent_mutation Average:95.027; most accessible tissue: Zhenshan97 panicle, score: 96.953 N N N N
vg0222163084 C -> T LOC_Os02g36740.8 downstream_gene_variant ; 178.0bp to feature; MODIFIER silent_mutation Average:95.027; most accessible tissue: Zhenshan97 panicle, score: 96.953 N N N N
vg0222163084 C -> T LOC_Os02g36740.2 downstream_gene_variant ; 215.0bp to feature; MODIFIER silent_mutation Average:95.027; most accessible tissue: Zhenshan97 panicle, score: 96.953 N N N N
vg0222163084 C -> T LOC_Os02g36740.4 downstream_gene_variant ; 215.0bp to feature; MODIFIER silent_mutation Average:95.027; most accessible tissue: Zhenshan97 panicle, score: 96.953 N N N N
vg0222163084 C -> T LOC_Os02g36740.5 downstream_gene_variant ; 215.0bp to feature; MODIFIER silent_mutation Average:95.027; most accessible tissue: Zhenshan97 panicle, score: 96.953 N N N N
vg0222163084 C -> T LOC_Os02g36740.7 downstream_gene_variant ; 215.0bp to feature; MODIFIER silent_mutation Average:95.027; most accessible tissue: Zhenshan97 panicle, score: 96.953 N N N N
vg0222163084 C -> T LOC_Os02g36740.3 downstream_gene_variant ; 215.0bp to feature; MODIFIER silent_mutation Average:95.027; most accessible tissue: Zhenshan97 panicle, score: 96.953 N N N N
vg0222163084 C -> T LOC_Os02g36730-LOC_Os02g36740 intergenic_region ; MODIFIER silent_mutation Average:95.027; most accessible tissue: Zhenshan97 panicle, score: 96.953 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0222163084 C T -0.04 -0.02 -0.02 -0.02 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222163084 NA 1.11E-07 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 NA 1.91E-07 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 NA 3.68E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 NA 4.14E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 2.27E-06 NA mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 NA 5.64E-11 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 8.74E-06 NA mr1101 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 NA 5.72E-07 mr1150 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 NA 1.14E-06 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 NA 6.65E-09 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 NA 8.03E-06 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 1.63E-06 NA mr1877 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 NA 3.05E-07 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 1.01E-07 NA mr1911 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 2.75E-06 8.06E-06 mr1911 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 2.90E-09 NA mr1918 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 1.83E-07 3.80E-08 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 1.72E-07 1.48E-11 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 1.68E-06 2.51E-08 mr1929 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 NA 1.54E-07 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 NA 4.58E-06 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 9.84E-07 NA mr1095_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 1.30E-06 1.75E-06 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 NA 8.70E-08 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 1.98E-06 NA mr1099_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 4.25E-06 1.40E-07 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 2.88E-06 NA mr1124_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 6.82E-07 1.85E-08 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 3.94E-06 6.47E-06 mr1146_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 NA 4.42E-08 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 NA 7.75E-10 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 1.61E-07 NA mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 3.47E-07 3.06E-07 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 NA 1.69E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 NA 1.51E-08 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 4.83E-09 NA mr1911_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 9.93E-08 NA mr1911_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 7.72E-10 NA mr1918_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 3.28E-08 2.04E-08 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 3.18E-08 3.89E-10 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222163084 6.56E-07 9.33E-08 mr1929_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251