| Variant ID: vg0222160124 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22160124 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCATAATGGGACAAACCCCCAACTTCTATCAATAAGATGATCTACTAAAATAATATTTCCAAAATCACATAAATTCTATCACAAAATTCTATAGGTACCA[T/C]
GTCATCCAAACTAGAATAAAAGTTCCGTGGCTACCAATTCCAAGCGTGTAACACCATTGAACATGTTAACTATCTATCTTTTTTTAATGTTGTCAAAAGT
ACTTTTGACAACATTAAAAAAAGATAGATAGTTAACATGTTCAATGGTGTTACACGCTTGGAATTGGTAGCCACGGAACTTTTATTCTAGTTTGGATGAC[A/G]
TGGTACCTATAGAATTTTGTGATAGAATTTATGTGATTTTGGAAATATTATTTTAGTAGATCATCTTATTGATAGAAGTTGGGGGTTTGTCCCATTATGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.40% | 9.40% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 70.80% | 28.30% | 0.86% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 44.50% | 54.00% | 1.56% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.60% | 5.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222160124 | T -> C | LOC_Os02g36710.1 | upstream_gene_variant ; 4082.0bp to feature; MODIFIER | silent_mutation | Average:43.634; most accessible tissue: Minghui63 root, score: 66.549 | N | N | N | N |
| vg0222160124 | T -> C | LOC_Os02g36720.1 | upstream_gene_variant ; 1766.0bp to feature; MODIFIER | silent_mutation | Average:43.634; most accessible tissue: Minghui63 root, score: 66.549 | N | N | N | N |
| vg0222160124 | T -> C | LOC_Os02g36730.1 | upstream_gene_variant ; 1203.0bp to feature; MODIFIER | silent_mutation | Average:43.634; most accessible tissue: Minghui63 root, score: 66.549 | N | N | N | N |
| vg0222160124 | T -> C | LOC_Os02g36740.1 | downstream_gene_variant ; 3175.0bp to feature; MODIFIER | silent_mutation | Average:43.634; most accessible tissue: Minghui63 root, score: 66.549 | N | N | N | N |
| vg0222160124 | T -> C | LOC_Os02g36740.8 | downstream_gene_variant ; 3138.0bp to feature; MODIFIER | silent_mutation | Average:43.634; most accessible tissue: Minghui63 root, score: 66.549 | N | N | N | N |
| vg0222160124 | T -> C | LOC_Os02g36740.2 | downstream_gene_variant ; 3175.0bp to feature; MODIFIER | silent_mutation | Average:43.634; most accessible tissue: Minghui63 root, score: 66.549 | N | N | N | N |
| vg0222160124 | T -> C | LOC_Os02g36740.4 | downstream_gene_variant ; 3175.0bp to feature; MODIFIER | silent_mutation | Average:43.634; most accessible tissue: Minghui63 root, score: 66.549 | N | N | N | N |
| vg0222160124 | T -> C | LOC_Os02g36740.5 | downstream_gene_variant ; 3175.0bp to feature; MODIFIER | silent_mutation | Average:43.634; most accessible tissue: Minghui63 root, score: 66.549 | N | N | N | N |
| vg0222160124 | T -> C | LOC_Os02g36740.7 | downstream_gene_variant ; 3175.0bp to feature; MODIFIER | silent_mutation | Average:43.634; most accessible tissue: Minghui63 root, score: 66.549 | N | N | N | N |
| vg0222160124 | T -> C | LOC_Os02g36740.3 | downstream_gene_variant ; 3175.0bp to feature; MODIFIER | silent_mutation | Average:43.634; most accessible tissue: Minghui63 root, score: 66.549 | N | N | N | N |
| vg0222160124 | T -> C | LOC_Os02g36720-LOC_Os02g36730 | intergenic_region ; MODIFIER | silent_mutation | Average:43.634; most accessible tissue: Minghui63 root, score: 66.549 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222160124 | NA | 1.32E-09 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0222160124 | NA | 1.29E-18 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0222160124 | NA | 9.58E-13 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0222160124 | NA | 4.38E-09 | mr1606 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222160124 | NA | 8.31E-07 | mr1606 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222160124 | NA | 1.00E-07 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222160124 | NA | 5.72E-10 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222160124 | NA | 1.54E-06 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222160124 | NA | 1.90E-09 | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222160124 | NA | 1.01E-07 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222160124 | NA | 1.34E-08 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222160124 | NA | 2.11E-07 | mr1880_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |