\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222160124:

Variant ID: vg0222160124 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22160124
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCATAATGGGACAAACCCCCAACTTCTATCAATAAGATGATCTACTAAAATAATATTTCCAAAATCACATAAATTCTATCACAAAATTCTATAGGTACCA[T/C]
GTCATCCAAACTAGAATAAAAGTTCCGTGGCTACCAATTCCAAGCGTGTAACACCATTGAACATGTTAACTATCTATCTTTTTTTAATGTTGTCAAAAGT

Reverse complement sequence

ACTTTTGACAACATTAAAAAAAGATAGATAGTTAACATGTTCAATGGTGTTACACGCTTGGAATTGGTAGCCACGGAACTTTTATTCTAGTTTGGATGAC[A/G]
TGGTACCTATAGAATTTTGTGATAGAATTTATGTGATTTTGGAAATATTATTTTAGTAGATCATCTTATTGATAGAAGTTGGGGGTTTGTCCCATTATGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.40% 9.40% 0.30% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 70.80% 28.30% 0.86% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 44.50% 54.00% 1.56% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 94.60% 5.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 3.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222160124 T -> C LOC_Os02g36710.1 upstream_gene_variant ; 4082.0bp to feature; MODIFIER silent_mutation Average:43.634; most accessible tissue: Minghui63 root, score: 66.549 N N N N
vg0222160124 T -> C LOC_Os02g36720.1 upstream_gene_variant ; 1766.0bp to feature; MODIFIER silent_mutation Average:43.634; most accessible tissue: Minghui63 root, score: 66.549 N N N N
vg0222160124 T -> C LOC_Os02g36730.1 upstream_gene_variant ; 1203.0bp to feature; MODIFIER silent_mutation Average:43.634; most accessible tissue: Minghui63 root, score: 66.549 N N N N
vg0222160124 T -> C LOC_Os02g36740.1 downstream_gene_variant ; 3175.0bp to feature; MODIFIER silent_mutation Average:43.634; most accessible tissue: Minghui63 root, score: 66.549 N N N N
vg0222160124 T -> C LOC_Os02g36740.8 downstream_gene_variant ; 3138.0bp to feature; MODIFIER silent_mutation Average:43.634; most accessible tissue: Minghui63 root, score: 66.549 N N N N
vg0222160124 T -> C LOC_Os02g36740.2 downstream_gene_variant ; 3175.0bp to feature; MODIFIER silent_mutation Average:43.634; most accessible tissue: Minghui63 root, score: 66.549 N N N N
vg0222160124 T -> C LOC_Os02g36740.4 downstream_gene_variant ; 3175.0bp to feature; MODIFIER silent_mutation Average:43.634; most accessible tissue: Minghui63 root, score: 66.549 N N N N
vg0222160124 T -> C LOC_Os02g36740.5 downstream_gene_variant ; 3175.0bp to feature; MODIFIER silent_mutation Average:43.634; most accessible tissue: Minghui63 root, score: 66.549 N N N N
vg0222160124 T -> C LOC_Os02g36740.7 downstream_gene_variant ; 3175.0bp to feature; MODIFIER silent_mutation Average:43.634; most accessible tissue: Minghui63 root, score: 66.549 N N N N
vg0222160124 T -> C LOC_Os02g36740.3 downstream_gene_variant ; 3175.0bp to feature; MODIFIER silent_mutation Average:43.634; most accessible tissue: Minghui63 root, score: 66.549 N N N N
vg0222160124 T -> C LOC_Os02g36720-LOC_Os02g36730 intergenic_region ; MODIFIER silent_mutation Average:43.634; most accessible tissue: Minghui63 root, score: 66.549 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222160124 NA 1.32E-09 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0222160124 NA 1.29E-18 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0222160124 NA 9.58E-13 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0222160124 NA 4.38E-09 mr1606 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222160124 NA 8.31E-07 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222160124 NA 1.00E-07 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222160124 NA 5.72E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222160124 NA 1.54E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222160124 NA 1.90E-09 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222160124 NA 1.01E-07 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222160124 NA 1.34E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222160124 NA 2.11E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251