\
| Variant ID: vg0222145571 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22145571 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 259. )
CCTTCCAAGTCCATATGTGTATTACGCATGCATGAATAACAAAATCTATACTACCTTCTTCAAGCCAATTTTCAGAAAGTGCTTTTTTTAAAAAAAAACA[C/T]
GGTATAAACATAAACGTTCCCTATAAATGCATATACACATACCCCTACAAGAGCCTTTGAAAAACTGGGCAAGTATATCTTGAAATTAACGAAGTTTATC
GATAAACTTCGTTAATTTCAAGATATACTTGCCCAGTTTTTCAAAGGCTCTTGTAGGGGTATGTGTATATGCATTTATAGGGAACGTTTATGTTTATACC[G/A]
TGTTTTTTTTTAAAAAAAGCACTTTCTGAAAATTGGCTTGAAGAAGGTAGTATAGATTTTGTTATTCATGCATGCGTAATACACATATGGACTTGGAAGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.10% | 8.70% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 95.70% | 4.20% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 84.20% | 15.10% | 0.66% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.20% | 6.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 93.90% | 6.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 90.90% | 8.70% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 90.10% | 9.70% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 50.60% | 46.90% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 41.70% | 58.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222145571 | C -> T | LOC_Os02g36680.1 | upstream_gene_variant ; 3575.0bp to feature; MODIFIER | silent_mutation | Average:40.964; most accessible tissue: Callus, score: 59.089 | N | N | N | N |
| vg0222145571 | C -> T | LOC_Os02g36690.1 | upstream_gene_variant ; 573.0bp to feature; MODIFIER | silent_mutation | Average:40.964; most accessible tissue: Callus, score: 59.089 | N | N | N | N |
| vg0222145571 | C -> T | LOC_Os02g36700.1 | downstream_gene_variant ; 849.0bp to feature; MODIFIER | silent_mutation | Average:40.964; most accessible tissue: Callus, score: 59.089 | N | N | N | N |
| vg0222145571 | C -> T | LOC_Os02g36690-LOC_Os02g36700 | intergenic_region ; MODIFIER | silent_mutation | Average:40.964; most accessible tissue: Callus, score: 59.089 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222145571 | NA | 2.20E-06 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222145571 | NA | 4.53E-06 | mr1913 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222145571 | NA | 5.84E-07 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222145571 | NA | 4.05E-06 | mr1113_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222145571 | NA | 2.00E-06 | mr1118_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222145571 | NA | 9.43E-06 | mr1123_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222145571 | NA | 4.01E-06 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222145571 | 8.29E-08 | NA | mr1334_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222145571 | NA | 9.48E-07 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222145571 | NA | 5.02E-07 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222145571 | NA | 9.62E-06 | mr1720_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222145571 | 1.54E-06 | NA | mr1991_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |