\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222145571:

Variant ID: vg0222145571 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22145571
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


CCTTCCAAGTCCATATGTGTATTACGCATGCATGAATAACAAAATCTATACTACCTTCTTCAAGCCAATTTTCAGAAAGTGCTTTTTTTAAAAAAAAACA[C/T]
GGTATAAACATAAACGTTCCCTATAAATGCATATACACATACCCCTACAAGAGCCTTTGAAAAACTGGGCAAGTATATCTTGAAATTAACGAAGTTTATC

Reverse complement sequence

GATAAACTTCGTTAATTTCAAGATATACTTGCCCAGTTTTTCAAAGGCTCTTGTAGGGGTATGTGTATATGCATTTATAGGGAACGTTTATGTTTATACC[G/A]
TGTTTTTTTTTAAAAAAAGCACTTTCTGAAAATTGGCTTGAAGAAGGTAGTATAGATTTTGTTATTCATGCATGCGTAATACACATATGGACTTGGAAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.10% 8.70% 0.25% 0.00% NA
All Indica  2759 95.70% 4.20% 0.07% 0.00% NA
All Japonica  1512 84.20% 15.10% 0.66% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.80% 1.00% 0.17% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 93.20% 6.70% 0.11% 0.00% NA
Indica Intermediate  786 93.90% 6.10% 0.00% 0.00% NA
Temperate Japonica  767 90.90% 8.70% 0.39% 0.00% NA
Tropical Japonica  504 90.10% 9.70% 0.20% 0.00% NA
Japonica Intermediate  241 50.60% 46.90% 2.49% 0.00% NA
VI/Aromatic  96 41.70% 58.30% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222145571 C -> T LOC_Os02g36680.1 upstream_gene_variant ; 3575.0bp to feature; MODIFIER silent_mutation Average:40.964; most accessible tissue: Callus, score: 59.089 N N N N
vg0222145571 C -> T LOC_Os02g36690.1 upstream_gene_variant ; 573.0bp to feature; MODIFIER silent_mutation Average:40.964; most accessible tissue: Callus, score: 59.089 N N N N
vg0222145571 C -> T LOC_Os02g36700.1 downstream_gene_variant ; 849.0bp to feature; MODIFIER silent_mutation Average:40.964; most accessible tissue: Callus, score: 59.089 N N N N
vg0222145571 C -> T LOC_Os02g36690-LOC_Os02g36700 intergenic_region ; MODIFIER silent_mutation Average:40.964; most accessible tissue: Callus, score: 59.089 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222145571 NA 2.20E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145571 NA 4.53E-06 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145571 NA 5.84E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145571 NA 4.05E-06 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145571 NA 2.00E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145571 NA 9.43E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145571 NA 4.01E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145571 8.29E-08 NA mr1334_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145571 NA 9.48E-07 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145571 NA 5.02E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145571 NA 9.62E-06 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145571 1.54E-06 NA mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251