Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0222145571:

Variant ID: vg0222145571 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 22145571
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

CCTTCCAAGTCCATATGTGTATTACGCATGCATGAATAACAAAATCTATACTACCTTCTTCAAGCCAATTTTCAGAAAGTGCTTTTTTTAAAAAAAAACA[C/T]
GGTATAAACATAAACGTTCCCTATAAATGCATATACACATACCCCTACAAGAGCCTTTGAAAAACTGGGCAAGTATATCTTGAAATTAACGAAGTTTATC

Reverse complement sequence

GATAAACTTCGTTAATTTCAAGATATACTTGCCCAGTTTTTCAAAGGCTCTTGTAGGGGTATGTGTATATGCATTTATAGGGAACGTTTATGTTTATACC[G/A]
TGTTTTTTTTTAAAAAAAGCACTTTCTGAAAATTGGCTTGAAGAAGGTAGTATAGATTTTGTTATTCATGCATGCGTAATACACATATGGACTTGGAAGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.10%	8.70%	0.25%	0.00%	NA
All Indica	2759	95.70%	4.20%	0.07%	0.00%	NA
All Japonica	1512	84.20%	15.10%	0.66%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.80%	1.00%	0.17%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	93.20%	6.70%	0.11%	0.00%	NA
Indica Intermediate	786	93.90%	6.10%	0.00%	0.00%	NA
Temperate Japonica	767	90.90%	8.70%	0.39%	0.00%	NA
Tropical Japonica	504	90.10%	9.70%	0.20%	0.00%	NA
Japonica Intermediate	241	50.60%	46.90%	2.49%	0.00%	NA
VI/Aromatic	96	41.70%	58.30%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222145571	C -> T	LOC_Os02g36680.1	upstream_gene_variant ; 3575.0bp to feature; MODIFIER	silent_mutation	Average:40.964; most accessible tissue: Callus, score: 59.089	N	N	N	N
vg0222145571	C -> T	LOC_Os02g36690.1	upstream_gene_variant ; 573.0bp to feature; MODIFIER	silent_mutation	Average:40.964; most accessible tissue: Callus, score: 59.089	N	N	N	N
vg0222145571	C -> T	LOC_Os02g36700.1	downstream_gene_variant ; 849.0bp to feature; MODIFIER	silent_mutation	Average:40.964; most accessible tissue: Callus, score: 59.089	N	N	N	N
vg0222145571	C -> T	LOC_Os02g36690-LOC_Os02g36700	intergenic_region ; MODIFIER	silent_mutation	Average:40.964; most accessible tissue: Callus, score: 59.089	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222145571	NA	2.20E-06	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145571	NA	4.53E-06	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145571	NA	5.84E-07	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145571	NA	4.05E-06	mr1113_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145571	NA	2.00E-06	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145571	NA	9.43E-06	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145571	NA	4.01E-06	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145571	8.29E-08	NA	mr1334_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145571	NA	9.48E-07	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145571	NA	5.02E-07	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145571	NA	9.62E-06	mr1720_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145571	1.54E-06	NA	mr1991_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251