\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222145560:

Variant ID: vg0222145560 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22145560
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, T: 0.05, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


CAATTGTTGCCCCTTCCAAGTCCATATGTGTATTACGCATGCATGAATAACAAAATCTATACTACCTTCTTCAAGCCAATTTTCAGAAAGTGCTTTTTTT[A/T]
AAAAAAAACACGGTATAAACATAAACGTTCCCTATAAATGCATATACACATACCCCTACAAGAGCCTTTGAAAAACTGGGCAAGTATATCTTGAAATTAA

Reverse complement sequence

TTAATTTCAAGATATACTTGCCCAGTTTTTCAAAGGCTCTTGTAGGGGTATGTGTATATGCATTTATAGGGAACGTTTATGTTTATACCGTGTTTTTTTT[T/A]
AAAAAAAGCACTTTCTGAAAATTGGCTTGAAGAAGGTAGTATAGATTTTGTTATTCATGCATGCGTAATACACATATGGACTTGGAAGGGGCAACAATTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.20% 16.50% 0.30% 0.00% NA
All Indica  2759 95.30% 4.60% 0.11% 0.00% NA
All Japonica  1512 62.80% 36.60% 0.60% 0.00% NA
Aus  269 72.90% 26.80% 0.37% 0.00% NA
Indica I  595 89.70% 10.10% 0.17% 0.00% NA
Indica II  465 98.90% 0.90% 0.22% 0.00% NA
Indica III  913 96.90% 3.10% 0.00% 0.00% NA
Indica Intermediate  786 95.30% 4.60% 0.13% 0.00% NA
Temperate Japonica  767 92.80% 6.60% 0.52% 0.00% NA
Tropical Japonica  504 14.30% 85.50% 0.20% 0.00% NA
Japonica Intermediate  241 68.90% 29.50% 1.66% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222145560 A -> T LOC_Os02g36680.1 upstream_gene_variant ; 3564.0bp to feature; MODIFIER silent_mutation Average:39.936; most accessible tissue: Callus, score: 59.089 N N N N
vg0222145560 A -> T LOC_Os02g36690.1 upstream_gene_variant ; 562.0bp to feature; MODIFIER silent_mutation Average:39.936; most accessible tissue: Callus, score: 59.089 N N N N
vg0222145560 A -> T LOC_Os02g36700.1 downstream_gene_variant ; 860.0bp to feature; MODIFIER silent_mutation Average:39.936; most accessible tissue: Callus, score: 59.089 N N N N
vg0222145560 A -> T LOC_Os02g36690-LOC_Os02g36700 intergenic_region ; MODIFIER silent_mutation Average:39.936; most accessible tissue: Callus, score: 59.089 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222145560 NA 3.08E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145560 NA 2.74E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145560 NA 3.23E-11 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145560 NA 9.85E-11 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145560 9.84E-06 7.78E-10 mr1129_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145560 NA 1.97E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145560 NA 1.12E-06 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145560 NA 1.50E-08 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145560 NA 4.11E-10 mr1250_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145560 NA 2.04E-10 mr1251_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145560 NA 5.11E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145560 NA 8.60E-07 mr1255_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145560 NA 6.91E-09 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145560 NA 1.23E-08 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145560 NA 2.42E-10 mr1435_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145560 NA 7.71E-06 mr1550_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145560 NA 5.77E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145560 NA 1.53E-09 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145560 NA 3.68E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145560 NA 9.95E-10 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145560 NA 3.67E-09 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145560 NA 1.85E-09 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222145560 NA 1.10E-10 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251