\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222060582:

Variant ID: vg0222060582 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22060582
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACATGCTTGACCGTTCGTCTTATTTAAAATAATTTGTGAAATATGTAAAAAGAATAAATAATATGAAAAGAATAAATAATTATTTAAATTTTTAAATAA[G/A]
ATGAATGGTCAAACACGTAATAAAAAGTCAACGGTGTCAACTATTTTTGAAACGGAAGGGAGTATATTGGGAGAGTAGAGTAGTCGAGCAGAGCTAGCGG

Reverse complement sequence

CCGCTAGCTCTGCTCGACTACTCTACTCTCCCAATATACTCCCTTCCGTTTCAAAAATAGTTGACACCGTTGACTTTTTATTACGTGTTTGACCATTCAT[C/T]
TTATTTAAAAATTTAAATAATTATTTATTCTTTTCATATTATTTATTCTTTTTACATATTTCACAAATTATTTTAAATAAGACGAACGGTCAAGCATGTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.60% 45.00% 0.42% 0.00% NA
All Indica  2759 77.60% 21.80% 0.65% 0.00% NA
All Japonica  1512 7.90% 92.10% 0.00% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 73.90% 24.70% 1.34% 0.00% NA
Indica II  465 94.20% 5.60% 0.22% 0.00% NA
Indica III  913 69.70% 29.90% 0.44% 0.00% NA
Indica Intermediate  786 79.60% 19.70% 0.64% 0.00% NA
Temperate Japonica  767 1.40% 98.60% 0.00% 0.00% NA
Tropical Japonica  504 19.20% 80.80% 0.00% 0.00% NA
Japonica Intermediate  241 5.00% 95.00% 0.00% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 48.90% 48.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222060582 G -> A LOC_Os02g36520.1 upstream_gene_variant ; 218.0bp to feature; MODIFIER silent_mutation Average:97.988; most accessible tissue: Minghui63 panicle, score: 98.619 N N N N
vg0222060582 G -> A LOC_Os02g36510.1 downstream_gene_variant ; 1971.0bp to feature; MODIFIER silent_mutation Average:97.988; most accessible tissue: Minghui63 panicle, score: 98.619 N N N N
vg0222060582 G -> A LOC_Os02g36530.1 downstream_gene_variant ; 4647.0bp to feature; MODIFIER silent_mutation Average:97.988; most accessible tissue: Minghui63 panicle, score: 98.619 N N N N
vg0222060582 G -> A LOC_Os02g36510-LOC_Os02g36520 intergenic_region ; MODIFIER silent_mutation Average:97.988; most accessible tissue: Minghui63 panicle, score: 98.619 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0222060582 G A -0.02 0.0 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222060582 NA 1.08E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060582 NA 3.57E-07 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060582 NA 5.70E-06 mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060582 NA 3.63E-06 mr1269 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060582 NA 1.74E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060582 NA 2.73E-07 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060582 NA 2.10E-09 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060582 NA 9.46E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060582 NA 6.15E-06 mr1633 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060582 4.98E-06 4.98E-06 mr1756 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060582 NA 8.78E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060582 NA 8.57E-06 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060582 NA 7.81E-06 mr1912 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060582 NA 2.26E-08 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060582 NA 4.44E-06 mr1976 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060582 NA 3.25E-12 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060582 NA 1.45E-06 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251