\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222060419:

Variant ID: vg0222060419 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 22060419
Reference Allele: GGTAlternative Allele: TGT,AGT,G
Primary Allele: TGTSecondary Allele: GGT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTGATTATCTCAGGATATGTTGATCCAATCCTTCGGACGTATTAATAATGATAGGGTTTACGTGTGTGTTTATAGAGATGCGTGTGTGCATGTGTTGTG[GGT/TGT,AGT,G]
GTCTCTGCTTAAGAAAAAAGTTACTCTGTTTCAAAATGTTTGACACCGTTGACTTTTTAGCACATGCTTGACCGTTCGTCTTATTTAAAATAATTTGTGA

Reverse complement sequence

TCACAAATTATTTTAAATAAGACGAACGGTCAAGCATGTGCTAAAAAGTCAACGGTGTCAAACATTTTGAAACAGAGTAACTTTTTTCTTAAGCAGAGAC[ACC/ACA,ACT,C]
CACAACACATGCACACACGCATCTCTATAAACACACACGTAAACCCTATCATTATTAATACGTCCGAAGGATTGGATCAACATATCCTGAGATAATCAAT

Allele Frequencies:

Populations Population SizeFrequency of TGT(primary allele) Frequency of GGT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.20% 48.20% 0.40% 0.00% AGT: 0.08%; G: 0.04%
All Indica  2759 74.70% 24.60% 0.58% 0.00% AGT: 0.14%
All Japonica  1512 7.90% 91.90% 0.13% 0.00% G: 0.13%
Aus  269 70.30% 29.40% 0.37% 0.00% NA
Indica I  595 71.10% 27.90% 1.01% 0.00% NA
Indica II  465 90.50% 9.50% 0.00% 0.00% NA
Indica III  913 68.50% 30.60% 0.55% 0.00% AGT: 0.44%
Indica Intermediate  786 75.20% 24.20% 0.64% 0.00% NA
Temperate Japonica  767 1.30% 98.40% 0.26% 0.00% NA
Tropical Japonica  504 19.20% 80.80% 0.00% 0.00% NA
Japonica Intermediate  241 5.00% 94.20% 0.00% 0.00% G: 0.83%
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 46.70% 53.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222060419 GGT -> AGT LOC_Os02g36520.1 upstream_gene_variant ; 381.0bp to feature; MODIFIER silent_mutation Average:76.597; most accessible tissue: Minghui63 panicle, score: 89.702 N N N N
vg0222060419 GGT -> AGT LOC_Os02g36510.1 downstream_gene_variant ; 1808.0bp to feature; MODIFIER silent_mutation Average:76.597; most accessible tissue: Minghui63 panicle, score: 89.702 N N N N
vg0222060419 GGT -> AGT LOC_Os02g36530.1 downstream_gene_variant ; 4810.0bp to feature; MODIFIER silent_mutation Average:76.597; most accessible tissue: Minghui63 panicle, score: 89.702 N N N N
vg0222060419 GGT -> AGT LOC_Os02g36510-LOC_Os02g36520 intergenic_region ; MODIFIER silent_mutation Average:76.597; most accessible tissue: Minghui63 panicle, score: 89.702 N N N N
vg0222060419 GGT -> G LOC_Os02g36520.1 upstream_gene_variant ; 380.0bp to feature; MODIFIER silent_mutation Average:76.597; most accessible tissue: Minghui63 panicle, score: 89.702 N N N N
vg0222060419 GGT -> G LOC_Os02g36510.1 downstream_gene_variant ; 1809.0bp to feature; MODIFIER silent_mutation Average:76.597; most accessible tissue: Minghui63 panicle, score: 89.702 N N N N
vg0222060419 GGT -> G LOC_Os02g36530.1 downstream_gene_variant ; 4809.0bp to feature; MODIFIER silent_mutation Average:76.597; most accessible tissue: Minghui63 panicle, score: 89.702 N N N N
vg0222060419 GGT -> G LOC_Os02g36510-LOC_Os02g36520 intergenic_region ; MODIFIER silent_mutation Average:76.597; most accessible tissue: Minghui63 panicle, score: 89.702 N N N N
vg0222060419 GGT -> TGT LOC_Os02g36520.1 upstream_gene_variant ; 381.0bp to feature; MODIFIER silent_mutation Average:76.597; most accessible tissue: Minghui63 panicle, score: 89.702 N N N N
vg0222060419 GGT -> TGT LOC_Os02g36510.1 downstream_gene_variant ; 1808.0bp to feature; MODIFIER silent_mutation Average:76.597; most accessible tissue: Minghui63 panicle, score: 89.702 N N N N
vg0222060419 GGT -> TGT LOC_Os02g36530.1 downstream_gene_variant ; 4810.0bp to feature; MODIFIER silent_mutation Average:76.597; most accessible tissue: Minghui63 panicle, score: 89.702 N N N N
vg0222060419 GGT -> TGT LOC_Os02g36510-LOC_Os02g36520 intergenic_region ; MODIFIER silent_mutation Average:76.597; most accessible tissue: Minghui63 panicle, score: 89.702 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0222060419 GGT AGT -0.01 0.0 -0.01 -0.01 -0.01 -0.01
vg0222060419 GGT G 0.0 0.09 0.18 -0.01 0.06 0.1
vg0222060419 GGT TGT 0.01 0.01 0.01 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222060419 NA 7.21E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060419 NA 5.75E-09 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060419 NA 8.28E-10 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060419 NA 1.55E-06 mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060419 NA 1.05E-06 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060419 NA 1.08E-09 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060419 NA 9.93E-06 mr1633 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060419 NA 5.24E-09 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060419 NA 8.33E-06 mr1698 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060419 NA 3.03E-10 mr1950 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060419 NA 5.22E-09 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060419 NA 7.62E-14 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060419 NA 1.21E-06 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060419 NA 9.30E-06 mr1454_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222060419 NA 5.93E-06 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251