| Variant ID: vg0222036258 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22036258 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 96. )
GGAAGTTTCGGGCCTGGAAAGCCGGAAGTTCCGGAGTTCCTTACCAGGAAGTTCCGGGTCTGTTTGAATTTTACCGCTGCGATTTGTTTCTAAGTTTTCA[G/A]
GGACAGCCTATTCACCCCCCCCCCTCTAGGCTTCATCACCGCGTTCAATGATAATAATTTCACATCACATTTTAGGGTAAGAAACCACTTGACGAATATA
TATATTCGTCAAGTGGTTTCTTACCCTAAAATGTGATGTGAAATTATTATCATTGAACGCGGTGATGAAGCCTAGAGGGGGGGGGGTGAATAGGCTGTCC[C/T]
TGAAAACTTAGAAACAAATCGCAGCGGTAAAATTCAAACAGACCCGGAACTTCCTGGTAAGGAACTCCGGAACTTCCGGCTTTCCAGGCCCGAAACTTCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.70% | 47.00% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 77.40% | 22.10% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 7.80% | 92.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 69.50% | 30.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 74.30% | 25.00% | 0.67% | 0.00% | NA |
| Indica II | 465 | 90.30% | 9.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 72.10% | 27.50% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 78.40% | 21.20% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 19.20% | 80.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.00% | 94.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 55.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222036258 | G -> A | LOC_Os02g36470.1 | downstream_gene_variant ; 4561.0bp to feature; MODIFIER | silent_mutation | Average:20.621; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 | N | N | N | N |
| vg0222036258 | G -> A | LOC_Os02g36480.1 | downstream_gene_variant ; 2009.0bp to feature; MODIFIER | silent_mutation | Average:20.621; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 | N | N | N | N |
| vg0222036258 | G -> A | LOC_Os02g36490.1 | downstream_gene_variant ; 2346.0bp to feature; MODIFIER | silent_mutation | Average:20.621; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 | N | N | N | N |
| vg0222036258 | G -> A | LOC_Os02g36490.2 | downstream_gene_variant ; 2346.0bp to feature; MODIFIER | silent_mutation | Average:20.621; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 | N | N | N | N |
| vg0222036258 | G -> A | LOC_Os02g36490.3 | downstream_gene_variant ; 2346.0bp to feature; MODIFIER | silent_mutation | Average:20.621; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 | N | N | N | N |
| vg0222036258 | G -> A | LOC_Os02g36480-LOC_Os02g36490 | intergenic_region ; MODIFIER | silent_mutation | Average:20.621; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222036258 | NA | 4.49E-07 | mr1224 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222036258 | NA | 1.37E-06 | mr1225 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222036258 | NA | 4.80E-06 | mr1607 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222036258 | NA | 3.42E-06 | mr1633 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222036258 | NA | 5.52E-07 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222036258 | NA | 1.10E-14 | mr1188_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222036258 | NA | 9.13E-07 | mr1188_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222036258 | NA | 6.16E-07 | mr1330_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222036258 | NA | 4.20E-06 | mr1336_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222036258 | NA | 5.98E-06 | mr1454_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |