\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222036258:

Variant ID: vg0222036258 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22036258
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


GGAAGTTTCGGGCCTGGAAAGCCGGAAGTTCCGGAGTTCCTTACCAGGAAGTTCCGGGTCTGTTTGAATTTTACCGCTGCGATTTGTTTCTAAGTTTTCA[G/A]
GGACAGCCTATTCACCCCCCCCCCTCTAGGCTTCATCACCGCGTTCAATGATAATAATTTCACATCACATTTTAGGGTAAGAAACCACTTGACGAATATA

Reverse complement sequence

TATATTCGTCAAGTGGTTTCTTACCCTAAAATGTGATGTGAAATTATTATCATTGAACGCGGTGATGAAGCCTAGAGGGGGGGGGGTGAATAGGCTGTCC[C/T]
TGAAAACTTAGAAACAAATCGCAGCGGTAAAATTCAAACAGACCCGGAACTTCCTGGTAAGGAACTCCGGAACTTCCGGCTTTCCAGGCCCGAAACTTCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.70% 47.00% 0.30% 0.00% NA
All Indica  2759 77.40% 22.10% 0.43% 0.00% NA
All Japonica  1512 7.80% 92.10% 0.07% 0.00% NA
Aus  269 69.50% 30.50% 0.00% 0.00% NA
Indica I  595 74.30% 25.00% 0.67% 0.00% NA
Indica II  465 90.30% 9.50% 0.22% 0.00% NA
Indica III  913 72.10% 27.50% 0.44% 0.00% NA
Indica Intermediate  786 78.40% 21.20% 0.38% 0.00% NA
Temperate Japonica  767 1.20% 98.80% 0.00% 0.00% NA
Tropical Japonica  504 19.20% 80.80% 0.00% 0.00% NA
Japonica Intermediate  241 5.00% 94.60% 0.41% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 43.30% 55.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222036258 G -> A LOC_Os02g36470.1 downstream_gene_variant ; 4561.0bp to feature; MODIFIER silent_mutation Average:20.621; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 N N N N
vg0222036258 G -> A LOC_Os02g36480.1 downstream_gene_variant ; 2009.0bp to feature; MODIFIER silent_mutation Average:20.621; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 N N N N
vg0222036258 G -> A LOC_Os02g36490.1 downstream_gene_variant ; 2346.0bp to feature; MODIFIER silent_mutation Average:20.621; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 N N N N
vg0222036258 G -> A LOC_Os02g36490.2 downstream_gene_variant ; 2346.0bp to feature; MODIFIER silent_mutation Average:20.621; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 N N N N
vg0222036258 G -> A LOC_Os02g36490.3 downstream_gene_variant ; 2346.0bp to feature; MODIFIER silent_mutation Average:20.621; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 N N N N
vg0222036258 G -> A LOC_Os02g36480-LOC_Os02g36490 intergenic_region ; MODIFIER silent_mutation Average:20.621; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222036258 NA 4.49E-07 mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222036258 NA 1.37E-06 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222036258 NA 4.80E-06 mr1607 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222036258 NA 3.42E-06 mr1633 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222036258 NA 5.52E-07 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222036258 NA 1.10E-14 mr1188_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222036258 NA 9.13E-07 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222036258 NA 6.16E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222036258 NA 4.20E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222036258 NA 5.98E-06 mr1454_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251