Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0222035625:

Variant ID: vg0222035625 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 22035625
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:

GAGAGGGAGAGAAGAAGATTTGGAGAGGTGTGAAGACTAGGAACTTGTGTGAGCACTTGGAATATCTCGTGGGCTGTCATCTCGGTGCTTATTACTCTTG[G/T]
AGATGATCTCCTAGACGGTTAGGTGTCGCCCGCGAGAATCCATTGCATATTGTGGATGTCCCGGGTAAGTTTGTGAAGGATCTCCTCTCCTCCGAAAGGG

Reverse complement sequence

CCCTTTCGGAGGAGAGGAGATCCTTCACAAACTTACCCGGGACATCCACAATATGCAATGGATTCTCGCGGGCGACACCTAACCGTCTAGGAGATCATCT[C/A]
CAAGAGTAATAAGCACCGAGATGACAGCCCACGAGATATTCCAAGTGCTCACACAAGTTCCTAGTCTTCACACCTCTCCAAATCTTCTTCTCTCCCTCTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.60%	2.20%	1.16%	0.00%	NA
All Indica	2759	99.90%	0.00%	0.07%	0.00%	NA
All Japonica	1512	89.60%	6.90%	3.51%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.00%	0.13%	0.00%	NA
Temperate Japonica	767	84.40%	10.00%	5.61%	0.00%	NA
Tropical Japonica	504	99.40%	0.00%	0.60%	0.00%	NA
Japonica Intermediate	241	85.90%	11.20%	2.90%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222035625	G -> T	LOC_Os02g36470.1	downstream_gene_variant ; 3928.0bp to feature; MODIFIER	silent_mutation	Average:25.004; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0222035625	G -> T	LOC_Os02g36480.1	downstream_gene_variant ; 1376.0bp to feature; MODIFIER	silent_mutation	Average:25.004; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0222035625	G -> T	LOC_Os02g36490.1	downstream_gene_variant ; 2979.0bp to feature; MODIFIER	silent_mutation	Average:25.004; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0222035625	G -> T	LOC_Os02g36490.2	downstream_gene_variant ; 2979.0bp to feature; MODIFIER	silent_mutation	Average:25.004; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0222035625	G -> T	LOC_Os02g36490.3	downstream_gene_variant ; 2979.0bp to feature; MODIFIER	silent_mutation	Average:25.004; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0222035625	G -> T	LOC_Os02g36480-LOC_Os02g36490	intergenic_region ; MODIFIER	silent_mutation	Average:25.004; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222035625	6.35E-07	6.35E-07	mr1166	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625	1.80E-06	1.43E-11	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625	NA	9.69E-06	mr1277	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625	4.82E-08	1.35E-12	mr1305	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625	NA	7.03E-06	mr1379	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625	1.88E-11	1.88E-11	mr1409	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625	NA	1.29E-08	mr1515	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625	2.01E-06	2.32E-13	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625	4.85E-08	1.41E-13	mr1586	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625	2.87E-08	3.66E-12	mr1765	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625	NA	6.82E-06	mr1793	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625	7.54E-07	7.54E-07	mr1803	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625	1.19E-06	6.80E-11	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625	NA	9.54E-06	mr1409_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625	NA	3.96E-06	mr1559_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625	NA	4.49E-13	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625	NA	5.03E-06	mr1703_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625	NA	1.51E-06	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251