\
| Variant ID: vg0222035625 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22035625 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 327. )
GAGAGGGAGAGAAGAAGATTTGGAGAGGTGTGAAGACTAGGAACTTGTGTGAGCACTTGGAATATCTCGTGGGCTGTCATCTCGGTGCTTATTACTCTTG[G/T]
AGATGATCTCCTAGACGGTTAGGTGTCGCCCGCGAGAATCCATTGCATATTGTGGATGTCCCGGGTAAGTTTGTGAAGGATCTCCTCTCCTCCGAAAGGG
CCCTTTCGGAGGAGAGGAGATCCTTCACAAACTTACCCGGGACATCCACAATATGCAATGGATTCTCGCGGGCGACACCTAACCGTCTAGGAGATCATCT[C/A]
CAAGAGTAATAAGCACCGAGATGACAGCCCACGAGATATTCCAAGTGCTCACACAAGTTCCTAGTCTTCACACCTCTCCAAATCTTCTTCTCTCCCTCTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.60% | 2.20% | 1.16% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 89.60% | 6.90% | 3.51% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 84.40% | 10.00% | 5.61% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.90% | 11.20% | 2.90% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222035625 | G -> T | LOC_Os02g36470.1 | downstream_gene_variant ; 3928.0bp to feature; MODIFIER | silent_mutation | Average:25.004; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0222035625 | G -> T | LOC_Os02g36480.1 | downstream_gene_variant ; 1376.0bp to feature; MODIFIER | silent_mutation | Average:25.004; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0222035625 | G -> T | LOC_Os02g36490.1 | downstream_gene_variant ; 2979.0bp to feature; MODIFIER | silent_mutation | Average:25.004; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0222035625 | G -> T | LOC_Os02g36490.2 | downstream_gene_variant ; 2979.0bp to feature; MODIFIER | silent_mutation | Average:25.004; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0222035625 | G -> T | LOC_Os02g36490.3 | downstream_gene_variant ; 2979.0bp to feature; MODIFIER | silent_mutation | Average:25.004; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0222035625 | G -> T | LOC_Os02g36480-LOC_Os02g36490 | intergenic_region ; MODIFIER | silent_mutation | Average:25.004; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222035625 | 6.35E-07 | 6.35E-07 | mr1166 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222035625 | 1.80E-06 | 1.43E-11 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222035625 | NA | 9.69E-06 | mr1277 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222035625 | 4.82E-08 | 1.35E-12 | mr1305 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222035625 | NA | 7.03E-06 | mr1379 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222035625 | 1.88E-11 | 1.88E-11 | mr1409 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222035625 | NA | 1.29E-08 | mr1515 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222035625 | 2.01E-06 | 2.32E-13 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222035625 | 4.85E-08 | 1.41E-13 | mr1586 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222035625 | 2.87E-08 | 3.66E-12 | mr1765 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222035625 | NA | 6.82E-06 | mr1793 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222035625 | 7.54E-07 | 7.54E-07 | mr1803 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222035625 | 1.19E-06 | 6.80E-11 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222035625 | NA | 9.54E-06 | mr1409_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222035625 | NA | 3.96E-06 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222035625 | NA | 4.49E-13 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222035625 | NA | 5.03E-06 | mr1703_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222035625 | NA | 1.51E-06 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |