\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222035625:

Variant ID: vg0222035625 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22035625
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:


GAGAGGGAGAGAAGAAGATTTGGAGAGGTGTGAAGACTAGGAACTTGTGTGAGCACTTGGAATATCTCGTGGGCTGTCATCTCGGTGCTTATTACTCTTG[G/T]
AGATGATCTCCTAGACGGTTAGGTGTCGCCCGCGAGAATCCATTGCATATTGTGGATGTCCCGGGTAAGTTTGTGAAGGATCTCCTCTCCTCCGAAAGGG

Reverse complement sequence

CCCTTTCGGAGGAGAGGAGATCCTTCACAAACTTACCCGGGACATCCACAATATGCAATGGATTCTCGCGGGCGACACCTAACCGTCTAGGAGATCATCT[C/A]
CAAGAGTAATAAGCACCGAGATGACAGCCCACGAGATATTCCAAGTGCTCACACAAGTTCCTAGTCTTCACACCTCTCCAAATCTTCTTCTCTCCCTCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.60% 2.20% 1.16% 0.00% NA
All Indica  2759 99.90% 0.00% 0.07% 0.00% NA
All Japonica  1512 89.60% 6.90% 3.51% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.00% 0.13% 0.00% NA
Temperate Japonica  767 84.40% 10.00% 5.61% 0.00% NA
Tropical Japonica  504 99.40% 0.00% 0.60% 0.00% NA
Japonica Intermediate  241 85.90% 11.20% 2.90% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222035625 G -> T LOC_Os02g36470.1 downstream_gene_variant ; 3928.0bp to feature; MODIFIER silent_mutation Average:25.004; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0222035625 G -> T LOC_Os02g36480.1 downstream_gene_variant ; 1376.0bp to feature; MODIFIER silent_mutation Average:25.004; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0222035625 G -> T LOC_Os02g36490.1 downstream_gene_variant ; 2979.0bp to feature; MODIFIER silent_mutation Average:25.004; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0222035625 G -> T LOC_Os02g36490.2 downstream_gene_variant ; 2979.0bp to feature; MODIFIER silent_mutation Average:25.004; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0222035625 G -> T LOC_Os02g36490.3 downstream_gene_variant ; 2979.0bp to feature; MODIFIER silent_mutation Average:25.004; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0222035625 G -> T LOC_Os02g36480-LOC_Os02g36490 intergenic_region ; MODIFIER silent_mutation Average:25.004; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222035625 6.35E-07 6.35E-07 mr1166 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625 1.80E-06 1.43E-11 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625 NA 9.69E-06 mr1277 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625 4.82E-08 1.35E-12 mr1305 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625 NA 7.03E-06 mr1379 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625 1.88E-11 1.88E-11 mr1409 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625 NA 1.29E-08 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625 2.01E-06 2.32E-13 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625 4.85E-08 1.41E-13 mr1586 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625 2.87E-08 3.66E-12 mr1765 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625 NA 6.82E-06 mr1793 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625 7.54E-07 7.54E-07 mr1803 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625 1.19E-06 6.80E-11 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625 NA 9.54E-06 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625 NA 3.96E-06 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625 NA 4.49E-13 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625 NA 5.03E-06 mr1703_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222035625 NA 1.51E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251