Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222022581:

Variant ID: vg0222022581 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 22022581
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

GGATTTAAAAACCGACTCAAACATGAATGACGTACCAAAATACTGACAAAAACATCTTCAATCTATCTATCTATCTATCTATCTATTATATACTAAAAGT[C/T]
CATTAAACTTCCTATAAACGTTCTCAAGCCGCCACGTGGCACTTCTACAAACGCTCCTAGACCGCCACGTGGCAATGTTTAATCTCACCATCGATTTTCA

Reverse complement sequence

TGAAAATCGATGGTGAGATTAAACATTGCCACGTGGCGGTCTAGGAGCGTTTGTAGAAGTGCCACGTGGCGGCTTGAGAACGTTTATAGGAAGTTTAATG[G/A]
ACTTTTAGTATATAATAGATAGATAGATAGATAGATAGATTGAAGATGTTTTTGTCAGTATTTTGGTACGTCATTCATGTTTGAGTCGGTTTTTAAATCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.50%	10.20%	0.25%	0.00%	NA
All Indica	2759	85.10%	14.50%	0.43%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	72.50%	27.50%	0.00%	0.00%	NA
Indica I	595	79.20%	19.80%	1.01%	0.00%	NA
Indica II	465	92.30%	7.70%	0.00%	0.00%	NA
Indica III	913	80.80%	18.80%	0.33%	0.00%	NA
Indica Intermediate	786	90.20%	9.40%	0.38%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222022581	C -> T	LOC_Os02g36470.1	upstream_gene_variant ; 3498.0bp to feature; MODIFIER	silent_mutation	Average:35.4; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0222022581	C -> T	LOC_Os02g36450.1	downstream_gene_variant ; 4934.0bp to feature; MODIFIER	silent_mutation	Average:35.4; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0222022581	C -> T	LOC_Os02g36460.1	downstream_gene_variant ; 1603.0bp to feature; MODIFIER	silent_mutation	Average:35.4; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0222022581	C -> T	LOC_Os02g36450.2	downstream_gene_variant ; 4936.0bp to feature; MODIFIER	silent_mutation	Average:35.4; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0222022581	C -> T	LOC_Os02g36460-LOC_Os02g36470	intergenic_region ; MODIFIER	silent_mutation	Average:35.4; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222022581	NA	6.20E-06	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581	NA	3.59E-08	mr1095	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581	NA	6.23E-09	mr1098	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581	NA	2.65E-08	mr1099	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581	NA	1.78E-08	mr1101	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581	9.34E-06	2.05E-08	mr1224	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581	4.34E-06	1.11E-08	mr1225	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581	NA	7.14E-06	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581	NA	8.04E-07	mr1589	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581	NA	2.54E-06	mr1858	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581	NA	2.30E-06	mr1859	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581	NA	8.14E-06	mr1868	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581	NA	6.88E-09	mr1911	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581	NA	1.36E-06	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581	NA	4.60E-06	mr1098_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581	NA	6.43E-07	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581	NA	6.92E-06	mr1793_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251