\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222022581:

Variant ID: vg0222022581 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22022581
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


GGATTTAAAAACCGACTCAAACATGAATGACGTACCAAAATACTGACAAAAACATCTTCAATCTATCTATCTATCTATCTATCTATTATATACTAAAAGT[C/T]
CATTAAACTTCCTATAAACGTTCTCAAGCCGCCACGTGGCACTTCTACAAACGCTCCTAGACCGCCACGTGGCAATGTTTAATCTCACCATCGATTTTCA

Reverse complement sequence

TGAAAATCGATGGTGAGATTAAACATTGCCACGTGGCGGTCTAGGAGCGTTTGTAGAAGTGCCACGTGGCGGCTTGAGAACGTTTATAGGAAGTTTAATG[G/A]
ACTTTTAGTATATAATAGATAGATAGATAGATAGATAGATTGAAGATGTTTTTGTCAGTATTTTGGTACGTCATTCATGTTTGAGTCGGTTTTTAAATCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.50% 10.20% 0.25% 0.00% NA
All Indica  2759 85.10% 14.50% 0.43% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 72.50% 27.50% 0.00% 0.00% NA
Indica I  595 79.20% 19.80% 1.01% 0.00% NA
Indica II  465 92.30% 7.70% 0.00% 0.00% NA
Indica III  913 80.80% 18.80% 0.33% 0.00% NA
Indica Intermediate  786 90.20% 9.40% 0.38% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222022581 C -> T LOC_Os02g36470.1 upstream_gene_variant ; 3498.0bp to feature; MODIFIER silent_mutation Average:35.4; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0222022581 C -> T LOC_Os02g36450.1 downstream_gene_variant ; 4934.0bp to feature; MODIFIER silent_mutation Average:35.4; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0222022581 C -> T LOC_Os02g36460.1 downstream_gene_variant ; 1603.0bp to feature; MODIFIER silent_mutation Average:35.4; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0222022581 C -> T LOC_Os02g36450.2 downstream_gene_variant ; 4936.0bp to feature; MODIFIER silent_mutation Average:35.4; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0222022581 C -> T LOC_Os02g36460-LOC_Os02g36470 intergenic_region ; MODIFIER silent_mutation Average:35.4; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222022581 NA 6.20E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581 NA 3.59E-08 mr1095 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581 NA 6.23E-09 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581 NA 2.65E-08 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581 NA 1.78E-08 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581 9.34E-06 2.05E-08 mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581 4.34E-06 1.11E-08 mr1225 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581 NA 7.14E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581 NA 8.04E-07 mr1589 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581 NA 2.54E-06 mr1858 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581 NA 2.30E-06 mr1859 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581 NA 8.14E-06 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581 NA 6.88E-09 mr1911 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581 NA 1.36E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581 NA 4.60E-06 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581 NA 6.43E-07 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222022581 NA 6.92E-06 mr1793_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251