Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222019495:

Variant ID: vg0222019495 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 22019495
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTAATTTTGGATTTTATTTTATTTTTATTTCGAATTTTGATTATTCTCGTATTGGGTACTTATATGGAAACTTCTTTCAATATTGCTTATTTTTAATTC[T/C]
AAATTTCAGCTATTTTTATATTGTATTTCTACTTGGACTCTCCTTTTCTTTTTTTTTTCTTTTTCTCCGATTAATATGAGAATTTCTAGCTCCCACAGTG

Reverse complement sequence

CACTGTGGGAGCTAGAAATTCTCATATTAATCGGAGAAAAAGAAAAAAAAAAGAAAAGGAGAGTCCAAGTAGAAATACAATATAAAAATAGCTGAAATTT[A/G]
GAATTAAAAATAAGCAATATTGAAAGAAGTTTCCATATAAGTACCCAATACGAGAATAATCAAAATTCGAAATAAAAATAAAATAAAATCCAAAATTAGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.00%	36.80%	7.64%	1.65%	NA
All Indica	2759	76.80%	7.90%	12.47%	2.75%	NA
All Japonica	1512	7.70%	91.70%	0.53%	0.00%	NA
Aus	269	96.30%	2.20%	0.74%	0.74%	NA
Indica I	595	74.60%	6.20%	16.81%	2.35%	NA
Indica II	465	87.10%	1.50%	6.24%	5.16%	NA
Indica III	913	72.90%	8.80%	17.31%	0.99%	NA
Indica Intermediate	786	77.00%	12.10%	7.25%	3.69%	NA
Temperate Japonica	767	1.30%	98.20%	0.52%	0.00%	NA
Tropical Japonica	504	18.80%	80.40%	0.79%	0.00%	NA
Japonica Intermediate	241	5.00%	95.00%	0.00%	0.00%	NA
VI/Aromatic	96	12.50%	87.50%	0.00%	0.00%	NA
Intermediate	90	46.70%	45.60%	7.78%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222019495	T -> DEL	N	N	silent_mutation	Average:24.363; most accessible tissue: Callus, score: 52.083	N	N	N	N
vg0222019495	T -> C	LOC_Os02g36460.1	upstream_gene_variant ; 1131.0bp to feature; MODIFIER	silent_mutation	Average:24.363; most accessible tissue: Callus, score: 52.083	N	N	N	N
vg0222019495	T -> C	LOC_Os02g36450.1	downstream_gene_variant ; 1848.0bp to feature; MODIFIER	silent_mutation	Average:24.363; most accessible tissue: Callus, score: 52.083	N	N	N	N
vg0222019495	T -> C	LOC_Os02g36450.2	downstream_gene_variant ; 1850.0bp to feature; MODIFIER	silent_mutation	Average:24.363; most accessible tissue: Callus, score: 52.083	N	N	N	N
vg0222019495	T -> C	LOC_Os02g36450-LOC_Os02g36460	intergenic_region ; MODIFIER	silent_mutation	Average:24.363; most accessible tissue: Callus, score: 52.083	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222019495	NA	5.54E-09	Awn_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0222019495	NA	2.82E-28	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222019495	NA	2.16E-11	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222019495	1.63E-06	1.63E-06	mr1468	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222019495	NA	1.59E-10	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222019495	1.09E-06	1.09E-06	mr1866	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222019495	8.36E-06	8.36E-06	mr1978	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222019495	NA	1.37E-10	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222019495	NA	1.91E-08	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251