\
| Variant ID: vg0222019290 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22019290 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGAATTTCAGCTATTTTTAAAGTGTATTTCTACTTGAACTCTCATTTTCTTTTGTAATTTTAGATTTTACTTTATTTTTATTCTGAATTTTGATTAATCT[C/T]
GTATTGGGTTCTTATGTGGACTCTTCTTTTAATACTCCTTATTTTTAATTCCAAATTTCAGCTATTTTAAAATTGTATTCCTATATGGATTATCCTTTTC
GAAAAGGATAATCCATATAGGAATACAATTTTAAAATAGCTGAAATTTGGAATTAAAAATAAGGAGTATTAAAAGAAGAGTCCACATAAGAACCCAATAC[G/A]
AGATTAATCAAAATTCAGAATAAAAATAAAGTAAAATCTAAAATTACAAAAGAAAATGAGAGTTCAAGTAGAAATACACTTTAAAAATAGCTGAAATTCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.00% | 39.10% | 16.17% | 2.67% | NA |
| All Indica | 2759 | 16.00% | 56.10% | 23.56% | 4.35% | NA |
| All Japonica | 1512 | 92.40% | 6.20% | 1.32% | 0.07% | NA |
| Aus | 269 | 4.10% | 64.30% | 30.48% | 1.12% | NA |
| Indica I | 595 | 12.40% | 49.40% | 34.29% | 3.87% | NA |
| Indica II | 465 | 9.20% | 49.20% | 29.46% | 12.04% | NA |
| Indica III | 913 | 19.30% | 63.70% | 16.10% | 0.88% | NA |
| Indica Intermediate | 786 | 19.00% | 56.20% | 20.61% | 4.20% | NA |
| Temperate Japonica | 767 | 98.70% | 0.50% | 0.65% | 0.13% | NA |
| Tropical Japonica | 504 | 81.30% | 16.30% | 2.38% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.40% | 3.30% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 6.20% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 32.20% | 8.89% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222019290 | C -> T | LOC_Os02g36460.1 | upstream_gene_variant ; 1336.0bp to feature; MODIFIER | silent_mutation | Average:15.889; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0222019290 | C -> T | LOC_Os02g36450.1 | downstream_gene_variant ; 1643.0bp to feature; MODIFIER | silent_mutation | Average:15.889; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0222019290 | C -> T | LOC_Os02g36450.2 | downstream_gene_variant ; 1645.0bp to feature; MODIFIER | silent_mutation | Average:15.889; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0222019290 | C -> T | LOC_Os02g36450-LOC_Os02g36460 | intergenic_region ; MODIFIER | silent_mutation | Average:15.889; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0222019290 | C -> DEL | N | N | silent_mutation | Average:15.889; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222019290 | NA | 8.17E-08 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222019290 | NA | 6.68E-07 | mr1224 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222019290 | 3.59E-06 | 3.59E-06 | mr1556 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222019290 | NA | 3.42E-06 | mr1633 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222019290 | 6.30E-06 | 6.30E-06 | mr1738 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222019290 | 8.04E-07 | 8.04E-07 | mr1764 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222019290 | 2.31E-09 | 2.31E-09 | mr1978 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222019290 | NA | 2.90E-06 | mr1986 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222019290 | NA | 4.91E-06 | mr1265_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |