Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222019290:

Variant ID: vg0222019290 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 22019290
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGAATTTCAGCTATTTTTAAAGTGTATTTCTACTTGAACTCTCATTTTCTTTTGTAATTTTAGATTTTACTTTATTTTTATTCTGAATTTTGATTAATCT[C/T]
GTATTGGGTTCTTATGTGGACTCTTCTTTTAATACTCCTTATTTTTAATTCCAAATTTCAGCTATTTTAAAATTGTATTCCTATATGGATTATCCTTTTC

Reverse complement sequence

GAAAAGGATAATCCATATAGGAATACAATTTTAAAATAGCTGAAATTTGGAATTAAAAATAAGGAGTATTAAAAGAAGAGTCCACATAAGAACCCAATAC[G/A]
AGATTAATCAAAATTCAGAATAAAAATAAAGTAAAATCTAAAATTACAAAAGAAAATGAGAGTTCAAGTAGAAATACACTTTAAAAATAGCTGAAATTCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.00%	39.10%	16.17%	2.67%	NA
All Indica	2759	16.00%	56.10%	23.56%	4.35%	NA
All Japonica	1512	92.40%	6.20%	1.32%	0.07%	NA
Aus	269	4.10%	64.30%	30.48%	1.12%	NA
Indica I	595	12.40%	49.40%	34.29%	3.87%	NA
Indica II	465	9.20%	49.20%	29.46%	12.04%	NA
Indica III	913	19.30%	63.70%	16.10%	0.88%	NA
Indica Intermediate	786	19.00%	56.20%	20.61%	4.20%	NA
Temperate Japonica	767	98.70%	0.50%	0.65%	0.13%	NA
Tropical Japonica	504	81.30%	16.30%	2.38%	0.00%	NA
Japonica Intermediate	241	95.40%	3.30%	1.24%	0.00%	NA
VI/Aromatic	96	89.60%	6.20%	4.17%	0.00%	NA
Intermediate	90	56.70%	32.20%	8.89%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222019290	C -> T	LOC_Os02g36460.1	upstream_gene_variant ; 1336.0bp to feature; MODIFIER	silent_mutation	Average:15.889; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0222019290	C -> T	LOC_Os02g36450.1	downstream_gene_variant ; 1643.0bp to feature; MODIFIER	silent_mutation	Average:15.889; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0222019290	C -> T	LOC_Os02g36450.2	downstream_gene_variant ; 1645.0bp to feature; MODIFIER	silent_mutation	Average:15.889; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0222019290	C -> T	LOC_Os02g36450-LOC_Os02g36460	intergenic_region ; MODIFIER	silent_mutation	Average:15.889; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0222019290	C -> DEL	N	N	silent_mutation	Average:15.889; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222019290	NA	8.17E-08	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222019290	NA	6.68E-07	mr1224	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222019290	3.59E-06	3.59E-06	mr1556	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222019290	NA	3.42E-06	mr1633	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222019290	6.30E-06	6.30E-06	mr1738	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222019290	8.04E-07	8.04E-07	mr1764	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222019290	2.31E-09	2.31E-09	mr1978	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222019290	NA	2.90E-06	mr1986	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222019290	NA	4.91E-06	mr1265_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251