\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222017648:

Variant ID: vg0222017648 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22017648
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.82, C: 0.18, others allele: 0.00, population size: 62. )

Flanking Sequence (100 bp) in Reference Genome:


GTGGCCCGCGCAATTGCGTGGCTAACACCTAAACAAAACATATATTTTTTACTATGATTTTACTTAAAATTTATTAAATAGTTATGTCATTGTCTTAAGA[T/C]
TTTGAAAGACCAAACCTTATCATTTCTGTGTTTCTAATTATATAGTTTTTAAAAGTCACACCAGCTACTACCCCTTATGTCATCTCCTTCTTTATTTACT

Reverse complement sequence

AGTAAATAAAGAAGGAGATGACATAAGGGGTAGTAGCTGGTGTGACTTTTAAAAACTATATAATTAGAAACACAGAAATGATAAGGTTTGGTCTTTCAAA[A/G]
TCTTAAGACAATGACATAACTATTTAATAAATTTTAAGTAAAATCATAGTAAAAAATATATGTTTTGTTTAGGTGTTAGCCACGCAATTGCGCGGGCCAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.60% 31.10% 24.25% 7.09% NA
All Indica  2759 9.10% 42.40% 37.69% 10.87% NA
All Japonica  1512 92.00% 6.20% 1.59% 0.26% NA
Aus  269 3.30% 64.70% 22.30% 9.67% NA
Indica I  595 4.50% 45.50% 34.12% 15.80% NA
Indica II  465 3.40% 30.30% 52.90% 13.33% NA
Indica III  913 10.60% 51.00% 30.67% 7.67% NA
Indica Intermediate  786 14.00% 37.00% 39.57% 9.41% NA
Temperate Japonica  767 98.80% 0.70% 0.39% 0.13% NA
Tropical Japonica  504 80.20% 15.70% 3.57% 0.60% NA
Japonica Intermediate  241 95.00% 3.70% 1.24% 0.00% NA
VI/Aromatic  96 87.50% 10.40% 2.08% 0.00% NA
Intermediate  90 46.70% 25.60% 22.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222017648 T -> DEL N N silent_mutation Average:58.913; most accessible tissue: Minghui63 root, score: 82.511 N N N N
vg0222017648 T -> C LOC_Os02g36460.1 upstream_gene_variant ; 2978.0bp to feature; MODIFIER silent_mutation Average:58.913; most accessible tissue: Minghui63 root, score: 82.511 N N N N
vg0222017648 T -> C LOC_Os02g36450.1 downstream_gene_variant ; 1.0bp to feature; MODIFIER silent_mutation Average:58.913; most accessible tissue: Minghui63 root, score: 82.511 N N N N
vg0222017648 T -> C LOC_Os02g36450.2 downstream_gene_variant ; 3.0bp to feature; MODIFIER silent_mutation Average:58.913; most accessible tissue: Minghui63 root, score: 82.511 N N N N
vg0222017648 T -> C LOC_Os02g36450-LOC_Os02g36460 intergenic_region ; MODIFIER silent_mutation Average:58.913; most accessible tissue: Minghui63 root, score: 82.511 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222017648 NA 2.50E-07 Awn_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0222017648 1.60E-06 1.06E-07 mr1212 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222017648 NA 1.89E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222017648 NA 1.55E-08 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222017648 NA 1.96E-06 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222017648 NA 3.68E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251