\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222016029:

Variant ID: vg0222016029 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22016029
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, G: 0.01, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:


TCCTGCGGAAGATGTCCAGCGCGAAGCAGGACGCGTACTGCATCTTCGACAGCCAGGTGCTCAACGCCTTCGTCTCCTCCTTCTACCTCTCCACCATGGT[C/G]
GCCAGCCTTGTCGCCGGCCACCTAACCAAGACGCTGGGGAGGAGGAACTCGCTGCTGATCGCCGGCGTGCTCTTCTTCGCCGGCACCCTCCTCAACCTGG

Reverse complement sequence

CCAGGTTGAGGAGGGTGCCGGCGAAGAAGAGCACGCCGGCGATCAGCAGCGAGTTCCTCCTCCCCAGCGTCTTGGTTAGGTGGCCGGCGACAAGGCTGGC[G/C]
ACCATGGTGGAGAGGTAGAAGGAGGAGACGAAGGCGTTGAGCACCTGGCTGTCGAAGATGCAGTACGCGTCCTGCTTCGCGCTGGACATCTTCCGCAGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.00% 5.70% 0.74% 0.53% NA
All Indica  2759 89.40% 9.40% 1.16% 0.04% NA
All Japonica  1512 99.50% 0.20% 0.07% 0.20% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.50% 0.20% 1.34% 0.00% NA
Indica II  465 73.10% 24.50% 2.37% 0.00% NA
Indica III  913 94.00% 5.60% 0.33% 0.11% NA
Indica Intermediate  786 86.90% 11.80% 1.27% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 0.40% 0.41% 1.24% NA
VI/Aromatic  96 78.10% 0.00% 0.00% 21.88% NA
Intermediate  90 90.00% 7.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222016029 C -> G LOC_Os02g36450.1 synonymous_variant ; p.Val99Val; LOW synonymous_codon Average:43.057; most accessible tissue: Zhenshan97 flower, score: 61.872 N N N N
vg0222016029 C -> G LOC_Os02g36450.2 synonymous_variant ; p.Val62Val; LOW synonymous_codon Average:43.057; most accessible tissue: Zhenshan97 flower, score: 61.872 N N N N
vg0222016029 C -> DEL LOC_Os02g36450.1 N frameshift_variant Average:43.057; most accessible tissue: Zhenshan97 flower, score: 61.872 N N N N
vg0222016029 C -> DEL LOC_Os02g36450.2 N frameshift_variant Average:43.057; most accessible tissue: Zhenshan97 flower, score: 61.872 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222016029 NA 2.57E-08 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222016029 NA 1.90E-06 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222016029 8.43E-06 1.46E-08 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222016029 NA 2.04E-06 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222016029 NA 2.18E-06 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222016029 NA 7.50E-08 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222016029 5.61E-06 NA mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222016029 4.15E-06 3.99E-09 mr1150 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222016029 2.05E-06 1.77E-08 mr1197 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222016029 NA 2.32E-06 mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222016029 NA 9.30E-06 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222016029 NA 1.01E-06 mr1268 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222016029 NA 1.18E-06 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222016029 1.32E-06 NA mr1589 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222016029 1.10E-06 4.71E-09 mr1589 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222016029 NA 3.15E-06 mr1698 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222016029 7.64E-06 NA mr1868 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222016029 NA 2.73E-06 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222016029 NA 1.38E-12 mr1918 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222016029 NA 1.21E-08 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222016029 NA 4.88E-10 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222016029 NA 2.90E-07 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222016029 NA 1.20E-06 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251