\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222004983:

Variant ID: vg0222004983 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22004983
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTTCTACAATCTATTCTCTGCACTTTGATGCCGCTTATATTCTATTTACTGACTTTTTTCCAGAAGAAAAATAACTAATTCACCGATTATTAGGCCCCT[A/G]
ATTAATCACAATGGTGGAGCCACTCTATGCAGCTGTTGATTGGAGAATGTGAGGCATAGATGAATGGAACGGCACTGTTTACCGTTGGGCCCAAAGGCAG

Reverse complement sequence

CTGCCTTTGGGCCCAACGGTAAACAGTGCCGTTCCATTCATCTATGCCTCACATTCTCCAATCAACAGCTGCATAGAGTGGCTCCACCATTGTGATTAAT[T/C]
AGGGGCCTAATAATCGGTGAATTAGTTATTTTTCTTCTGGAAAAAAGTCAGTAAATAGAATATAAGCGGCATCAAAGTGCAGAGAATAGATTGTAGAACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.90% 46.40% 0.21% 2.41% NA
All Indica  2759 74.40% 23.80% 0.18% 1.63% NA
All Japonica  1512 7.70% 92.20% 0.07% 0.00% NA
Aus  269 69.50% 5.90% 0.00% 24.54% NA
Indica I  595 61.20% 36.00% 0.17% 2.69% NA
Indica II  465 90.80% 5.60% 0.43% 3.23% NA
Indica III  913 74.30% 25.20% 0.11% 0.44% NA
Indica Intermediate  786 74.90% 23.70% 0.13% 1.27% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 19.20% 80.60% 0.20% 0.00% NA
Japonica Intermediate  241 5.40% 94.60% 0.00% 0.00% NA
VI/Aromatic  96 10.40% 88.50% 0.00% 1.04% NA
Intermediate  90 44.40% 48.90% 4.44% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222004983 A -> G LOC_Os02g36440.1 upstream_gene_variant ; 2490.0bp to feature; MODIFIER silent_mutation Average:55.799; most accessible tissue: Callus, score: 93.238 N N N N
vg0222004983 A -> G LOC_Os02g36414.1 downstream_gene_variant ; 2248.0bp to feature; MODIFIER silent_mutation Average:55.799; most accessible tissue: Callus, score: 93.238 N N N N
vg0222004983 A -> G LOC_Os02g36430.1 downstream_gene_variant ; 761.0bp to feature; MODIFIER silent_mutation Average:55.799; most accessible tissue: Callus, score: 93.238 N N N N
vg0222004983 A -> G LOC_Os02g36414-LOC_Os02g36430 intergenic_region ; MODIFIER silent_mutation Average:55.799; most accessible tissue: Callus, score: 93.238 N N N N
vg0222004983 A -> DEL N N silent_mutation Average:55.799; most accessible tissue: Callus, score: 93.238 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222004983 NA 6.81E-07 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983 NA 4.80E-06 mr1007 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983 NA 2.54E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983 NA 7.69E-06 mr1021 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983 NA 8.74E-06 mr1034 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983 NA 1.09E-08 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983 NA 2.77E-08 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983 NA 1.83E-06 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983 NA 6.88E-06 mr1185 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983 NA 7.85E-06 mr1269 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983 NA 1.79E-07 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983 NA 4.16E-07 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983 NA 5.46E-07 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983 NA 7.81E-07 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983 NA 1.37E-09 mr1502 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983 NA 1.72E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983 NA 3.42E-06 mr1633 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983 NA 5.10E-18 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983 NA 6.93E-07 mr1912 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983 NA 2.68E-12 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983 NA 9.52E-07 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983 NA 1.57E-07 mr1975 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983 6.59E-06 6.59E-06 mr1978 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983 NA 2.16E-06 mr1986 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983 NA 5.54E-06 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983 NA 1.67E-06 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251