Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222004983:

Variant ID: vg0222004983 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 22004983
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTTCTACAATCTATTCTCTGCACTTTGATGCCGCTTATATTCTATTTACTGACTTTTTTCCAGAAGAAAAATAACTAATTCACCGATTATTAGGCCCCT[A/G]
ATTAATCACAATGGTGGAGCCACTCTATGCAGCTGTTGATTGGAGAATGTGAGGCATAGATGAATGGAACGGCACTGTTTACCGTTGGGCCCAAAGGCAG

Reverse complement sequence

CTGCCTTTGGGCCCAACGGTAAACAGTGCCGTTCCATTCATCTATGCCTCACATTCTCCAATCAACAGCTGCATAGAGTGGCTCCACCATTGTGATTAAT[T/C]
AGGGGCCTAATAATCGGTGAATTAGTTATTTTTCTTCTGGAAAAAAGTCAGTAAATAGAATATAAGCGGCATCAAAGTGCAGAGAATAGATTGTAGAACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.90%	46.40%	0.21%	2.41%	NA
All Indica	2759	74.40%	23.80%	0.18%	1.63%	NA
All Japonica	1512	7.70%	92.20%	0.07%	0.00%	NA
Aus	269	69.50%	5.90%	0.00%	24.54%	NA
Indica I	595	61.20%	36.00%	0.17%	2.69%	NA
Indica II	465	90.80%	5.60%	0.43%	3.23%	NA
Indica III	913	74.30%	25.20%	0.11%	0.44%	NA
Indica Intermediate	786	74.90%	23.70%	0.13%	1.27%	NA
Temperate Japonica	767	0.90%	99.10%	0.00%	0.00%	NA
Tropical Japonica	504	19.20%	80.60%	0.20%	0.00%	NA
Japonica Intermediate	241	5.40%	94.60%	0.00%	0.00%	NA
VI/Aromatic	96	10.40%	88.50%	0.00%	1.04%	NA
Intermediate	90	44.40%	48.90%	4.44%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222004983	A -> G	LOC_Os02g36440.1	upstream_gene_variant ; 2490.0bp to feature; MODIFIER	silent_mutation	Average:55.799; most accessible tissue: Callus, score: 93.238	N	N	N	N
vg0222004983	A -> G	LOC_Os02g36414.1	downstream_gene_variant ; 2248.0bp to feature; MODIFIER	silent_mutation	Average:55.799; most accessible tissue: Callus, score: 93.238	N	N	N	N
vg0222004983	A -> G	LOC_Os02g36430.1	downstream_gene_variant ; 761.0bp to feature; MODIFIER	silent_mutation	Average:55.799; most accessible tissue: Callus, score: 93.238	N	N	N	N
vg0222004983	A -> G	LOC_Os02g36414-LOC_Os02g36430	intergenic_region ; MODIFIER	silent_mutation	Average:55.799; most accessible tissue: Callus, score: 93.238	N	N	N	N
vg0222004983	A -> DEL	N	N	silent_mutation	Average:55.799; most accessible tissue: Callus, score: 93.238	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222004983	NA	6.81E-07	mr1006	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983	NA	4.80E-06	mr1007	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983	NA	2.54E-06	mr1013	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983	NA	7.69E-06	mr1021	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983	NA	8.74E-06	mr1034	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983	NA	1.09E-08	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983	NA	2.77E-08	mr1043	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983	NA	1.83E-06	mr1052	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983	NA	6.88E-06	mr1185	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983	NA	7.85E-06	mr1269	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983	NA	1.79E-07	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983	NA	4.16E-07	mr1291	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983	NA	5.46E-07	mr1399	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983	NA	7.81E-07	mr1479	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983	NA	1.37E-09	mr1502	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983	NA	1.72E-06	mr1633	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983	NA	3.42E-06	mr1633	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983	NA	5.10E-18	mr1767	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983	NA	6.93E-07	mr1912	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983	NA	2.68E-12	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983	NA	9.52E-07	mr1950	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983	NA	1.57E-07	mr1975	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983	6.59E-06	6.59E-06	mr1978	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983	NA	2.16E-06	mr1986	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983	NA	5.54E-06	mr1265_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222004983	NA	1.67E-06	mr1860_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251