RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0221968611:

Variant ID: vg0221968611 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 21968611
Reference Allele: C	Alternative Allele: CA,CCA,CCG,A,CCCA,CCCG
Primary Allele: C	Secondary Allele: CA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCAAGGAGGCGGCCACGTCAAAATTGACAAATTCCACGTCGCGTCGCCGCCGCCAATGAGTACGTCTCACTAAAGAGCAGCTCAGTAACATCCCCCCCC[C/CA,CCA,CCG,A,CCCA,CCCG]
AGCACGCTCGCGTTGGTAAGGTGGGAACGGAGGTCCCTAGACCTCCCCAGTGGTCGAGCTCGGTGACGTCGCCGCCGTTGCCTAGCTCCCGCCGAACACC

Reverse complement sequence

GGTGTTCGGCGGGAGCTAGGCAACGGCGGCGACGTCACCGAGCTCGACCACTGGGGAGGTCTAGGGACCTCCGTTCCCACCTTACCAACGCGAGCGTGCT[G/TG,TGG,CGG,T,TGGG,CGGG]
GGGGGGGGATGTTACTGAGCTGCTCTTTAGTGAGACGTACTCATTGGCGGCGGCGACGCGACGTGGAATTTGTCAATTTTGACGTGGCCGCCTCCTTGAG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of CA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.00%	13.30%	17.46%	12.23%	A: 8.59%; CCA: 8.02%; CCG: 3.17%; CCCG: 1.40%; CCCA: 0.83%
All Indica	2759	5.20%	20.90%	26.42%	19.79%	CCA: 12.65%; A: 6.63%; CCG: 4.93%; CCCG: 2.10%; CCCA: 1.38%
All Japonica	1512	91.50%	0.30%	0.73%	0.60%	A: 6.22%; CCA: 0.40%; CCCG: 0.13%; CCG: 0.13%
Aus	269	1.10%	14.50%	25.28%	3.35%	A: 43.49%; CCA: 5.95%; CCG: 3.72%; CCCG: 2.23%; CCCA: 0.37%
Indica I	595	2.50%	8.10%	46.22%	5.04%	CCA: 18.49%; CCG: 11.09%; A: 5.04%; CCCA: 3.19%; CCCG: 0.34%
Indica II	465	3.40%	13.10%	23.01%	40.00%	CCA: 12.90%; A: 3.44%; CCG: 3.23%; CCCG: 0.86%
Indica III	913	4.30%	37.80%	14.68%	20.26%	CCA: 9.97%; A: 6.35%; CCCG: 3.61%; CCG: 2.08%; CCCA: 0.99%
Indica Intermediate	786	9.30%	15.60%	27.10%	18.45%	CCA: 11.20%; A: 10.05%; CCG: 4.58%; CCCG: 2.42%; CCCA: 1.27%
Temperate Japonica	767	98.20%	0.00%	0.78%	0.13%	A: 0.39%; CCA: 0.39%; CCCG: 0.13%
Tropical Japonica	504	80.00%	0.80%	0.60%	1.39%	A: 16.67%; CCG: 0.40%; CCCG: 0.20%
Japonica Intermediate	241	94.60%	0.00%	0.83%	0.41%	A: 2.90%; CCA: 1.24%
VI/Aromatic	96	91.70%	1.00%	2.08%	0.00%	A: 5.21%
Intermediate	90	38.90%	10.00%	16.67%	15.56%	CCA: 8.89%; A: 7.78%; CCG: 2.22%

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221968611	C -> A	LOC_Os02g36370.1	intron_variant ; MODIFIER	silent_mutation	Average:86.934; most accessible tissue: Minghui63 panicle, score: 93.053	N	N	N	N
vg0221968611	C -> CCA	LOC_Os02g36370.1	intron_variant ; MODIFIER	silent_mutation	Average:86.934; most accessible tissue: Minghui63 panicle, score: 93.053	N	N	N	N
vg0221968611	C -> DEL	N	N	silent_mutation	Average:86.934; most accessible tissue: Minghui63 panicle, score: 93.053	N	N	N	N
vg0221968611	C -> CCCA	LOC_Os02g36370.1	intron_variant ; MODIFIER	silent_mutation	Average:86.934; most accessible tissue: Minghui63 panicle, score: 93.053	N	N	N	N
vg0221968611	C -> CA	LOC_Os02g36370.1	intron_variant ; MODIFIER	silent_mutation	Average:86.934; most accessible tissue: Minghui63 panicle, score: 93.053	N	N	N	N
vg0221968611	C -> CCCG	LOC_Os02g36370.1	intron_variant ; MODIFIER	silent_mutation	Average:86.934; most accessible tissue: Minghui63 panicle, score: 93.053	N	N	N	N
vg0221968611	C -> CCG	LOC_Os02g36370.1	intron_variant ; MODIFIER	silent_mutation	Average:86.934; most accessible tissue: Minghui63 panicle, score: 93.053	N	N	N	N

Showing 1 to 7 of 7 entries

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Show entries

Search:

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0221968611	C	A	-0.03	-0.06	-0.04	-0.02	-0.02	-0.02
vg0221968611	C	CA	0.09	0.04	0.0	0.01	0.01	0.06
vg0221968611	C	CCA	0.22	0.02	-0.04	0.09	0.04	0.15
vg0221968611	C	CCCA	0.17	0.03	-0.06	0.1	0.03	0.12
vg0221968611	C	CCCG	0.18	0.03	-0.05	0.12	0.05	0.14
vg0221968611	C	CCG	0.26	0.04	-0.01	0.12	0.08	0.19

Showing 1 to 6 of 6 entries

Previous1Next

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221968611	NA	2.82E-16	mr1496	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221968611	NA	2.47E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221968611	1.61E-07	3.92E-10	mr1123_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221968611	NA	2.25E-07	mr1242_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221968611	NA	9.15E-06	mr1291_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221968611	4.03E-06	5.14E-15	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221968611	2.44E-07	2.15E-10	mr1496_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221968611	4.46E-06	2.96E-07	mr1936_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 8 of 8 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0221968611:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Effects Predicted by Deep Convolutional Neural Networks

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact