\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221957835:

Variant ID: vg0221957835 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21957835
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


TGGGAAATAAAAGCATATGCAAGAAAAAATAAGTGCCATTAATAATCATTGAGATGAAAGCATATGTAGAGGAAAAGAAAACATAATATTTCCACAAAAC[C/T]
GTTAGCTTCGCAGTATATAAAGAAAGGCGGGAAGCACCTTAAAACAGAGGACAAGTGGGCTGTGATGTGCTCCTCGTAGTGCGGTTGCGGAAAAGAGACA

Reverse complement sequence

TGTCTCTTTTCCGCAACCGCACTACGAGGAGCACATCACAGCCCACTTGTCCTCTGTTTTAAGGTGCTTCCCGCCTTTCTTTATATACTGCGAAGCTAAC[G/A]
GTTTTGTGGAAATATTATGTTTTCTTTTCCTCTACATATGCTTTCATCTCAATGATTATTAATGGCACTTATTTTTTCTTGCATATGCTTTTATTTCCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.10% 35.40% 0.15% 0.36% NA
All Indica  2759 50.20% 49.10% 0.18% 0.54% NA
All Japonica  1512 93.10% 6.70% 0.07% 0.07% NA
Aus  269 30.50% 69.50% 0.00% 0.00% NA
Indica I  595 25.00% 74.30% 0.17% 0.50% NA
Indica II  465 63.70% 35.50% 0.00% 0.86% NA
Indica III  913 60.60% 38.90% 0.33% 0.22% NA
Indica Intermediate  786 49.10% 50.00% 0.13% 0.76% NA
Temperate Japonica  767 99.20% 0.70% 0.00% 0.13% NA
Tropical Japonica  504 82.50% 17.30% 0.20% 0.00% NA
Japonica Intermediate  241 95.90% 4.10% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 71.10% 26.70% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221957835 C -> T LOC_Os02g36360.1 intron_variant ; MODIFIER silent_mutation Average:49.656; most accessible tissue: Minghui63 flower, score: 65.9 N N N N
vg0221957835 C -> T LOC_Os02g36360.2 intron_variant ; MODIFIER silent_mutation Average:49.656; most accessible tissue: Minghui63 flower, score: 65.9 N N N N
vg0221957835 C -> T LOC_Os02g36360.3 intron_variant ; MODIFIER silent_mutation Average:49.656; most accessible tissue: Minghui63 flower, score: 65.9 N N N N
vg0221957835 C -> DEL N N silent_mutation Average:49.656; most accessible tissue: Minghui63 flower, score: 65.9 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221957835 NA 5.15E-13 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221957835 NA 6.00E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221957835 NA 3.70E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221957835 NA 1.43E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221957835 NA 1.61E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221957835 NA 9.39E-08 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221957835 4.53E-06 NA mr1918 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221957835 NA 3.04E-07 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221957835 NA 4.29E-06 mr1057_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221957835 2.25E-06 9.21E-10 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221957835 NA 7.41E-06 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221957835 6.17E-06 NA mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221957835 1.20E-06 3.52E-08 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221957835 6.45E-06 3.70E-08 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221957835 2.37E-07 4.21E-08 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221957835 NA 2.67E-06 mr1298_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221957835 1.97E-06 NA mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221957835 NA 1.97E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221957835 NA 6.80E-06 mr1731_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221957835 1.75E-06 2.02E-12 mr1918_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221957835 NA 3.55E-06 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221957835 1.45E-06 1.44E-08 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251