Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221955252:

Variant ID: vg0221955252 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21955252
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGCTCCGCCCCTGCCTACAAATAGCCCCCCAGCCCAACTACCTAATTCCCCAATACCCATCCCCAAATCCCTGGCAGCCAATGCATCGAGGTAGTGAGC[T/C]
CCTGAACCCGTTCAGCTACGCAAGAGGTGAGTGGCGCCGGCGAGCTAATGACTTCTCTTAATCCAAGGAACTAGATAAGCTTGTAGGACATGTTGGAATT

Reverse complement sequence

AATTCCAACATGTCCTACAAGCTTATCTAGTTCCTTGGATTAAGAGAAGTCATTAGCTCGCCGGCGCCACTCACCTCTTGCGTAGCTGAACGGGTTCAGG[A/G]
GCTCACTACCTCGATGCATTGGCTGCCAGGGATTTGGGGATGGGTATTGGGGAATTAGGTAGTTGGGCTGGGGGGCTATTTGTAGGCAGGGGCGGAGCTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.40%	4.20%	0.42%	0.00%	NA
All Indica	2759	99.70%	0.30%	0.00%	0.00%	NA
All Japonica	1512	86.50%	12.20%	1.32%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	97.40%	1.30%	1.30%	0.00%	NA
Tropical Japonica	504	70.20%	28.60%	1.19%	0.00%	NA
Japonica Intermediate	241	85.90%	12.40%	1.66%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221955252	T -> C	LOC_Os02g36350.1	upstream_gene_variant ; 3477.0bp to feature; MODIFIER	silent_mutation	Average:70.205; most accessible tissue: Callus, score: 88.808	N	N	N	N
vg0221955252	T -> C	LOC_Os02g36350.2	upstream_gene_variant ; 3477.0bp to feature; MODIFIER	silent_mutation	Average:70.205; most accessible tissue: Callus, score: 88.808	N	N	N	N
vg0221955252	T -> C	LOC_Os02g36360.1	downstream_gene_variant ; 1336.0bp to feature; MODIFIER	silent_mutation	Average:70.205; most accessible tissue: Callus, score: 88.808	N	N	N	N
vg0221955252	T -> C	LOC_Os02g36360.2	downstream_gene_variant ; 1337.0bp to feature; MODIFIER	silent_mutation	Average:70.205; most accessible tissue: Callus, score: 88.808	N	N	N	N
vg0221955252	T -> C	LOC_Os02g36360.3	downstream_gene_variant ; 1337.0bp to feature; MODIFIER	silent_mutation	Average:70.205; most accessible tissue: Callus, score: 88.808	N	N	N	N
vg0221955252	T -> C	LOC_Os02g36350-LOC_Os02g36360	intergenic_region ; MODIFIER	silent_mutation	Average:70.205; most accessible tissue: Callus, score: 88.808	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221955252	NA	7.77E-07	mr1088	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221955252	NA	4.70E-06	mr1104	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221955252	NA	1.02E-07	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221955252	NA	4.42E-08	mr1225	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221955252	NA	1.16E-06	mr1246	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221955252	NA	1.71E-10	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221955252	NA	9.77E-06	mr1404	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221955252	NA	1.82E-07	mr1620	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221955252	NA	2.63E-06	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221955252	NA	1.73E-06	mr1228_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221955252	NA	5.75E-06	mr1232_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221955252	NA	8.88E-08	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221955252	NA	1.07E-06	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221955252	NA	1.78E-12	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221955252	NA	4.64E-06	mr1557_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221955252	NA	8.24E-07	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221955252	NA	2.84E-07	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221955252	NA	1.86E-07	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221955252	NA	4.09E-07	mr1696_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221955252	NA	3.18E-06	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221955252	NA	1.26E-07	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221955252	NA	1.36E-09	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221955252	NA	6.27E-07	mr1944_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221955252	NA	9.76E-07	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251