\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221953647:

Variant ID: vg0221953647 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21953647
Reference Allele: AAlternative Allele: C,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAATACTAATACTCACACGATACTTATCAGATACTTCTCCAATACCTAGCAGTGTAACCTCCTTGTTCAATAGCCCATTAAAGACCCAATGCTATACTT[A/C,T]
TGATATATTTATAACTTTAATATACTTGATCTATTTGTAATACAATGCTATATTTACTATATTTTCTGTAACAGGCAACAATACATAGAATATTTTTTAA

Reverse complement sequence

TTAAAAAATATTCTATGTATTGTTGCCTGTTACAGAAAATATAGTAAATATAGCATTGTATTACAAATAGATCAAGTATATTAAAGTTATAAATATATCA[T/G,A]
AAGTATAGCATTGGGTCTTTAATGGGCTATTGAACAAGGAGGTTACACTGCTAGGTATTGGAGAAGTATCTGATAAGTATCGTGTGAGTATTAGTATTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.40% 7.20% 0.36% 0.00% NA
All Indica  2759 98.70% 1.30% 0.00% 0.00% NA
All Japonica  1512 79.60% 19.40% 1.06% 0.00% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 96.90% 3.10% 0.00% 0.00% NA
Temperate Japonica  767 76.70% 22.20% 1.17% 0.00% NA
Tropical Japonica  504 78.00% 21.40% 0.60% 0.00% NA
Japonica Intermediate  241 92.10% 6.20% 1.66% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221953647 A -> T LOC_Os02g36350.1 upstream_gene_variant ; 1872.0bp to feature; MODIFIER N Average:66.162; most accessible tissue: Minghui63 root, score: 88.578 N N N N
vg0221953647 A -> T LOC_Os02g36350.2 upstream_gene_variant ; 1872.0bp to feature; MODIFIER N Average:66.162; most accessible tissue: Minghui63 root, score: 88.578 N N N N
vg0221953647 A -> T LOC_Os02g36360.1 downstream_gene_variant ; 2941.0bp to feature; MODIFIER N Average:66.162; most accessible tissue: Minghui63 root, score: 88.578 N N N N
vg0221953647 A -> T LOC_Os02g36360.2 downstream_gene_variant ; 2942.0bp to feature; MODIFIER N Average:66.162; most accessible tissue: Minghui63 root, score: 88.578 N N N N
vg0221953647 A -> T LOC_Os02g36360.3 downstream_gene_variant ; 2942.0bp to feature; MODIFIER N Average:66.162; most accessible tissue: Minghui63 root, score: 88.578 N N N N
vg0221953647 A -> T LOC_Os02g36350-LOC_Os02g36360 intergenic_region ; MODIFIER N Average:66.162; most accessible tissue: Minghui63 root, score: 88.578 N N N N
vg0221953647 A -> C LOC_Os02g36350.1 upstream_gene_variant ; 1872.0bp to feature; MODIFIER silent_mutation Average:66.162; most accessible tissue: Minghui63 root, score: 88.578 N N N N
vg0221953647 A -> C LOC_Os02g36350.2 upstream_gene_variant ; 1872.0bp to feature; MODIFIER silent_mutation Average:66.162; most accessible tissue: Minghui63 root, score: 88.578 N N N N
vg0221953647 A -> C LOC_Os02g36360.1 downstream_gene_variant ; 2941.0bp to feature; MODIFIER silent_mutation Average:66.162; most accessible tissue: Minghui63 root, score: 88.578 N N N N
vg0221953647 A -> C LOC_Os02g36360.2 downstream_gene_variant ; 2942.0bp to feature; MODIFIER silent_mutation Average:66.162; most accessible tissue: Minghui63 root, score: 88.578 N N N N
vg0221953647 A -> C LOC_Os02g36360.3 downstream_gene_variant ; 2942.0bp to feature; MODIFIER silent_mutation Average:66.162; most accessible tissue: Minghui63 root, score: 88.578 N N N N
vg0221953647 A -> C LOC_Os02g36350-LOC_Os02g36360 intergenic_region ; MODIFIER silent_mutation Average:66.162; most accessible tissue: Minghui63 root, score: 88.578 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221953647 9.00E-07 NA mr1042_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251