\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221953494:

Variant ID: vg0221953494 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21953494
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GCGGGCGGACGGCGGACGGCTATGTTGCACCTATACTTCACTTTCTTGCCGTATCGGTATCCGATACGTACCCGATACGGCGATACGTCCGGTACTCTGT[C/T]
GATACGGTATCGGAGGAGTATCAGTCATTAAACAATGAAAAAAAAGAAAAAATAAATACTAATACTCACACGATACTTATCAGATACTTCTCCAATACCT

Reverse complement sequence

AGGTATTGGAGAAGTATCTGATAAGTATCGTGTGAGTATTAGTATTTATTTTTTCTTTTTTTTCATTGTTTAATGACTGATACTCCTCCGATACCGTATC[G/A]
ACAGAGTACCGGACGTATCGCCGTATCGGGTACGTATCGGATACCGATACGGCAAGAAAGTGAAGTATAGGTGCAACATAGCCGTCCGCCGTCCGCCCGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 35.20% 0.32% 0.23% NA
All Indica  2759 50.30% 48.90% 0.47% 0.36% NA
All Japonica  1512 93.50% 6.50% 0.00% 0.07% NA
Aus  269 30.90% 69.10% 0.00% 0.00% NA
Indica I  595 24.90% 73.90% 0.84% 0.34% NA
Indica II  465 63.70% 35.30% 0.43% 0.65% NA
Indica III  913 60.70% 38.90% 0.33% 0.11% NA
Indica Intermediate  786 49.50% 49.60% 0.38% 0.51% NA
Temperate Japonica  767 99.20% 0.70% 0.00% 0.13% NA
Tropical Japonica  504 83.50% 16.50% 0.00% 0.00% NA
Japonica Intermediate  241 95.90% 4.10% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 68.90% 28.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221953494 C -> T LOC_Os02g36350.1 upstream_gene_variant ; 1719.0bp to feature; MODIFIER silent_mutation Average:81.228; most accessible tissue: Callus, score: 96.513 N N N N
vg0221953494 C -> T LOC_Os02g36350.2 upstream_gene_variant ; 1719.0bp to feature; MODIFIER silent_mutation Average:81.228; most accessible tissue: Callus, score: 96.513 N N N N
vg0221953494 C -> T LOC_Os02g36360.1 downstream_gene_variant ; 3094.0bp to feature; MODIFIER silent_mutation Average:81.228; most accessible tissue: Callus, score: 96.513 N N N N
vg0221953494 C -> T LOC_Os02g36360.2 downstream_gene_variant ; 3095.0bp to feature; MODIFIER silent_mutation Average:81.228; most accessible tissue: Callus, score: 96.513 N N N N
vg0221953494 C -> T LOC_Os02g36360.3 downstream_gene_variant ; 3095.0bp to feature; MODIFIER silent_mutation Average:81.228; most accessible tissue: Callus, score: 96.513 N N N N
vg0221953494 C -> T LOC_Os02g36350-LOC_Os02g36360 intergenic_region ; MODIFIER silent_mutation Average:81.228; most accessible tissue: Callus, score: 96.513 N N N N
vg0221953494 C -> DEL N N silent_mutation Average:81.228; most accessible tissue: Callus, score: 96.513 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0221953494 C T 0.02 -0.05 -0.03 -0.03 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221953494 NA 4.11E-12 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221953494 NA 9.25E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221953494 NA 4.65E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221953494 NA 9.88E-07 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221953494 NA 1.09E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221953494 NA 7.23E-08 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221953494 5.97E-06 NA mr1918 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221953494 NA 4.94E-07 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221953494 1.33E-06 3.66E-10 mr1074_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221953494 3.10E-06 9.19E-07 mr1095_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221953494 2.32E-06 NA mr1098_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221953494 3.65E-06 5.55E-06 mr1099_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221953494 3.78E-07 8.40E-09 mr1123_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221953494 4.87E-06 2.20E-08 mr1148_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221953494 8.73E-08 1.47E-08 mr1150_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221953494 NA 5.47E-06 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221953494 NA 1.62E-06 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221953494 NA 5.58E-06 mr1298_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221953494 7.41E-07 NA mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221953494 NA 3.06E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221953494 NA 1.53E-06 mr1786_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221953494 6.29E-06 4.44E-12 mr1918_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221953494 NA 1.40E-06 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221953494 5.26E-07 2.75E-09 mr1936_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251