| Variant ID: vg0221945123 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21945123 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATGTTAGCTCCAAGTGTTGTAATGTATTTAGCACTATAATATAACTATGATATTACACCTGATTATAAGTTGACTATAAAATTTAAAAAAAATCTAAAAG[C/T,A]
TTAGCGTTTAAACACATTTAATTTGTTTTTTATATTGATCTAGTTTAACTTGCATATTTATTTTTTGGAGTGATAAATTTTATTTTATCGTATAGAAAAT
ATTTTCTATACGATAAAATAAAATTTATCACTCCAAAAAATAAATATGCAAGTTAAACTAGATCAATATAAAAAACAAATTAAATGTGTTTAAACGCTAA[G/A,T]
CTTTTAGATTTTTTTTAAATTTTATAGTCAACTTATAATCAGGTGTAATATCATAGTTATATTATAGTGCTAAATACATTACAACACTTGGAGCTAACAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.70% | 26.20% | 5.80% | 13.97% | A: 0.34% |
| All Indica | 2759 | 36.60% | 34.00% | 8.77% | 19.97% | A: 0.58% |
| All Japonica | 1512 | 89.10% | 6.20% | 1.06% | 3.64% | NA |
| Aus | 269 | 30.50% | 68.40% | 0.37% | 0.74% | NA |
| Indica I | 595 | 24.00% | 62.40% | 3.53% | 9.41% | A: 0.67% |
| Indica II | 465 | 46.90% | 18.90% | 10.97% | 22.15% | A: 1.08% |
| Indica III | 913 | 38.00% | 22.50% | 10.41% | 28.70% | A: 0.44% |
| Indica Intermediate | 786 | 38.50% | 35.00% | 9.54% | 16.54% | A: 0.38% |
| Temperate Japonica | 767 | 99.00% | 0.70% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 73.40% | 16.50% | 2.58% | 7.54% | NA |
| Japonica Intermediate | 241 | 90.50% | 2.50% | 0.83% | 6.22% | NA |
| VI/Aromatic | 96 | 47.90% | 3.10% | 9.38% | 39.58% | NA |
| Intermediate | 90 | 60.00% | 17.80% | 6.67% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221945123 | C -> A | LOC_Os02g36350.1 | downstream_gene_variant ; 4761.0bp to feature; MODIFIER | silent_mutation | Average:28.42; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0221945123 | C -> A | LOC_Os02g36350.2 | downstream_gene_variant ; 4762.0bp to feature; MODIFIER | silent_mutation | Average:28.42; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0221945123 | C -> A | LOC_Os02g36340-LOC_Os02g36350 | intergenic_region ; MODIFIER | silent_mutation | Average:28.42; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0221945123 | C -> T | LOC_Os02g36350.1 | downstream_gene_variant ; 4761.0bp to feature; MODIFIER | silent_mutation | Average:28.42; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0221945123 | C -> T | LOC_Os02g36350.2 | downstream_gene_variant ; 4762.0bp to feature; MODIFIER | silent_mutation | Average:28.42; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0221945123 | C -> T | LOC_Os02g36340-LOC_Os02g36350 | intergenic_region ; MODIFIER | silent_mutation | Average:28.42; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0221945123 | C -> DEL | N | N | silent_mutation | Average:28.42; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221945123 | NA | 8.94E-13 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221945123 | NA | 8.44E-06 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221945123 | NA | 3.16E-06 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221945123 | NA | 2.87E-07 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221945123 | NA | 7.81E-06 | mr1795 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221945123 | NA | 2.17E-07 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221945123 | NA | 6.35E-08 | mr1861 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221945123 | NA | 1.65E-07 | mr1962 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221945123 | NA | 5.37E-06 | mr1057_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221945123 | 9.25E-06 | 2.98E-09 | mr1074_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/