Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221945123:

Variant ID: vg0221945123 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21945123
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGTTAGCTCCAAGTGTTGTAATGTATTTAGCACTATAATATAACTATGATATTACACCTGATTATAAGTTGACTATAAAATTTAAAAAAAATCTAAAAG[C/T,A]
TTAGCGTTTAAACACATTTAATTTGTTTTTTATATTGATCTAGTTTAACTTGCATATTTATTTTTTGGAGTGATAAATTTTATTTTATCGTATAGAAAAT

Reverse complement sequence

ATTTTCTATACGATAAAATAAAATTTATCACTCCAAAAAATAAATATGCAAGTTAAACTAGATCAATATAAAAAACAAATTAAATGTGTTTAAACGCTAA[G/A,T]
CTTTTAGATTTTTTTTAAATTTTATAGTCAACTTATAATCAGGTGTAATATCATAGTTATATTATAGTGCTAAATACATTACAACACTTGGAGCTAACAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.70%	26.20%	5.80%	13.97%	A: 0.34%
All Indica	2759	36.60%	34.00%	8.77%	19.97%	A: 0.58%
All Japonica	1512	89.10%	6.20%	1.06%	3.64%	NA
Aus	269	30.50%	68.40%	0.37%	0.74%	NA
Indica I	595	24.00%	62.40%	3.53%	9.41%	A: 0.67%
Indica II	465	46.90%	18.90%	10.97%	22.15%	A: 1.08%
Indica III	913	38.00%	22.50%	10.41%	28.70%	A: 0.44%
Indica Intermediate	786	38.50%	35.00%	9.54%	16.54%	A: 0.38%
Temperate Japonica	767	99.00%	0.70%	0.13%	0.26%	NA
Tropical Japonica	504	73.40%	16.50%	2.58%	7.54%	NA
Japonica Intermediate	241	90.50%	2.50%	0.83%	6.22%	NA
VI/Aromatic	96	47.90%	3.10%	9.38%	39.58%	NA
Intermediate	90	60.00%	17.80%	6.67%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221945123	C -> A	LOC_Os02g36350.1	downstream_gene_variant ; 4761.0bp to feature; MODIFIER	silent_mutation	Average:28.42; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0221945123	C -> A	LOC_Os02g36350.2	downstream_gene_variant ; 4762.0bp to feature; MODIFIER	silent_mutation	Average:28.42; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0221945123	C -> A	LOC_Os02g36340-LOC_Os02g36350	intergenic_region ; MODIFIER	silent_mutation	Average:28.42; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0221945123	C -> T	LOC_Os02g36350.1	downstream_gene_variant ; 4761.0bp to feature; MODIFIER	silent_mutation	Average:28.42; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0221945123	C -> T	LOC_Os02g36350.2	downstream_gene_variant ; 4762.0bp to feature; MODIFIER	silent_mutation	Average:28.42; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0221945123	C -> T	LOC_Os02g36340-LOC_Os02g36350	intergenic_region ; MODIFIER	silent_mutation	Average:28.42; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0221945123	C -> DEL	N	N	silent_mutation	Average:28.42; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221945123	NA	8.94E-13	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221945123	NA	8.44E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221945123	NA	3.16E-06	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221945123	NA	2.87E-07	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221945123	NA	7.81E-06	mr1795	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221945123	NA	2.17E-07	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221945123	NA	6.35E-08	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221945123	NA	1.65E-07	mr1962	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221945123	NA	5.37E-06	mr1057_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221945123	9.25E-06	2.98E-09	mr1074_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221945123	6.44E-07	1.12E-08	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221945123	NA	5.71E-08	mr1148_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221945123	1.39E-06	8.67E-08	mr1150_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221945123	3.21E-07	8.34E-13	mr1495_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221945123	NA	6.93E-07	mr1531_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221945123	5.48E-06	4.39E-12	mr1918_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221945123	NA	4.81E-06	mr1918_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221945123	2.75E-06	2.40E-08	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251