\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221919301:

Variant ID: vg0221919301 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21919301
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTTCTAACGCCGGTTTTTACGTTTTTTCTTCCGCGTTTTTTCATTTGGCGTTTCTTTTCGCTTTTTTTTTGCGCTTTTTTTTTAATCTTTTAGCACAC[A/G]
TGTTTTTTCAAATGTTTTGAGTTGAAAGTTTTTAAATATTGACTTAAAAATTTTCAAATTTGGCCTTGAGATTTTCAAATATCAAGTGAAAATTTTCGAA

Reverse complement sequence

TTCGAAAATTTTCACTTGATATTTGAAAATCTCAAGGCCAAATTTGAAAATTTTTAAGTCAATATTTAAAAACTTTCAACTCAAAACATTTGAAAAAACA[T/C]
GTGTGCTAAAAGATTAAAAAAAAAGCGCAAAAAAAAAGCGAAAAGAAACGCCAAATGAAAAAACGCGGAAGAAAAAACGTAAAAACCGGCGTTAGAAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.10% 8.40% 26.17% 0.30% NA
All Indica  2759 94.40% 0.60% 5.04% 0.00% NA
All Japonica  1512 9.50% 24.90% 64.75% 0.93% NA
Aus  269 98.90% 0.00% 1.12% 0.00% NA
Indica I  595 98.20% 1.50% 0.34% 0.00% NA
Indica II  465 98.10% 1.10% 0.86% 0.00% NA
Indica III  913 90.30% 0.00% 9.75% 0.00% NA
Indica Intermediate  786 94.10% 0.30% 5.60% 0.00% NA
Temperate Japonica  767 1.60% 46.30% 50.72% 1.43% NA
Tropical Japonica  504 22.20% 0.80% 76.59% 0.40% NA
Japonica Intermediate  241 7.90% 7.10% 84.65% 0.41% NA
VI/Aromatic  96 13.50% 0.00% 86.46% 0.00% NA
Intermediate  90 56.70% 6.70% 36.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221919301 A -> G LOC_Os02g36300.1 downstream_gene_variant ; 622.0bp to feature; MODIFIER silent_mutation Average:44.739; most accessible tissue: Callus, score: 89.355 N N N N
vg0221919301 A -> G LOC_Os02g36310.1 downstream_gene_variant ; 2306.0bp to feature; MODIFIER silent_mutation Average:44.739; most accessible tissue: Callus, score: 89.355 N N N N
vg0221919301 A -> G LOC_Os02g36320.1 downstream_gene_variant ; 3616.0bp to feature; MODIFIER silent_mutation Average:44.739; most accessible tissue: Callus, score: 89.355 N N N N
vg0221919301 A -> G LOC_Os02g36300-LOC_Os02g36310 intergenic_region ; MODIFIER silent_mutation Average:44.739; most accessible tissue: Callus, score: 89.355 N N N N
vg0221919301 A -> DEL N N silent_mutation Average:44.739; most accessible tissue: Callus, score: 89.355 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221919301 NA 3.76E-14 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0221919301 7.18E-06 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301 NA 1.86E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301 NA 2.26E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301 2.04E-07 NA mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301 NA 3.06E-08 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301 NA 1.62E-06 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301 NA 9.56E-07 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301 NA 1.83E-06 mr1269_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301 NA 5.93E-06 mr1479_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301 1.09E-07 4.64E-08 mr1502_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301 9.37E-07 2.54E-11 mr1502_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301 3.84E-11 7.37E-14 mr1543_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301 2.06E-08 6.59E-14 mr1543_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301 NA 6.22E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301 NA 3.31E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301 6.11E-06 NA mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301 NA 7.04E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301 1.34E-08 NA mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301 2.24E-06 2.28E-11 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301 4.17E-06 NA mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301 NA 1.59E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301 NA 4.69E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301 NA 4.61E-07 mr1892_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301 NA 3.00E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251