Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221919301:

Variant ID: vg0221919301 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21919301
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTTCTAACGCCGGTTTTTACGTTTTTTCTTCCGCGTTTTTTCATTTGGCGTTTCTTTTCGCTTTTTTTTTGCGCTTTTTTTTTAATCTTTTAGCACAC[A/G]
TGTTTTTTCAAATGTTTTGAGTTGAAAGTTTTTAAATATTGACTTAAAAATTTTCAAATTTGGCCTTGAGATTTTCAAATATCAAGTGAAAATTTTCGAA

Reverse complement sequence

TTCGAAAATTTTCACTTGATATTTGAAAATCTCAAGGCCAAATTTGAAAATTTTTAAGTCAATATTTAAAAACTTTCAACTCAAAACATTTGAAAAAACA[T/C]
GTGTGCTAAAAGATTAAAAAAAAAGCGCAAAAAAAAAGCGAAAAGAAACGCCAAATGAAAAAACGCGGAAGAAAAAACGTAAAAACCGGCGTTAGAAATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.10%	8.40%	26.17%	0.30%	NA
All Indica	2759	94.40%	0.60%	5.04%	0.00%	NA
All Japonica	1512	9.50%	24.90%	64.75%	0.93%	NA
Aus	269	98.90%	0.00%	1.12%	0.00%	NA
Indica I	595	98.20%	1.50%	0.34%	0.00%	NA
Indica II	465	98.10%	1.10%	0.86%	0.00%	NA
Indica III	913	90.30%	0.00%	9.75%	0.00%	NA
Indica Intermediate	786	94.10%	0.30%	5.60%	0.00%	NA
Temperate Japonica	767	1.60%	46.30%	50.72%	1.43%	NA
Tropical Japonica	504	22.20%	0.80%	76.59%	0.40%	NA
Japonica Intermediate	241	7.90%	7.10%	84.65%	0.41%	NA
VI/Aromatic	96	13.50%	0.00%	86.46%	0.00%	NA
Intermediate	90	56.70%	6.70%	36.67%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221919301	A -> G	LOC_Os02g36300.1	downstream_gene_variant ; 622.0bp to feature; MODIFIER	silent_mutation	Average:44.739; most accessible tissue: Callus, score: 89.355	N	N	N	N
vg0221919301	A -> G	LOC_Os02g36310.1	downstream_gene_variant ; 2306.0bp to feature; MODIFIER	silent_mutation	Average:44.739; most accessible tissue: Callus, score: 89.355	N	N	N	N
vg0221919301	A -> G	LOC_Os02g36320.1	downstream_gene_variant ; 3616.0bp to feature; MODIFIER	silent_mutation	Average:44.739; most accessible tissue: Callus, score: 89.355	N	N	N	N
vg0221919301	A -> G	LOC_Os02g36300-LOC_Os02g36310	intergenic_region ; MODIFIER	silent_mutation	Average:44.739; most accessible tissue: Callus, score: 89.355	N	N	N	N
vg0221919301	A -> DEL	N	N	silent_mutation	Average:44.739; most accessible tissue: Callus, score: 89.355	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221919301	NA	3.76E-14	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0221919301	7.18E-06	NA	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301	NA	1.86E-06	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301	NA	2.26E-07	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301	2.04E-07	NA	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301	NA	3.06E-08	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301	NA	1.62E-06	mr1043_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301	NA	9.56E-07	mr1051_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301	NA	1.83E-06	mr1269_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301	NA	5.93E-06	mr1479_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301	1.09E-07	4.64E-08	mr1502_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301	9.37E-07	2.54E-11	mr1502_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301	3.84E-11	7.37E-14	mr1543_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301	2.06E-08	6.59E-14	mr1543_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301	NA	6.22E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301	NA	3.31E-06	mr1588_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301	6.11E-06	NA	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301	NA	7.04E-07	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301	1.34E-08	NA	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301	2.24E-06	2.28E-11	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301	4.17E-06	NA	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301	NA	1.59E-06	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301	NA	4.69E-07	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301	NA	4.61E-07	mr1892_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221919301	NA	3.00E-07	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251