\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221907189:

Variant ID: vg0221907189 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21907189
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTGTAGGTGATTTTTACATGTTTTTTGAATCTGTGGATGATTTTGGGATGTAAATTTGTGGATGATTTCTAGATGTTTCTATGAAGTTGCAGATGAAT[A/C]
TGTGATGTCAATTTGCTGATGATTTTGTCTGTGTGATTGATGTTTTTGTCTGTGTGGTTGAGTTCGGTGCGAAATCAATATGAAAGTAGCAAAAAAAATA

Reverse complement sequence

TATTTTTTTTGCTACTTTCATATTGATTTCGCACCGAACTCAACCACACAGACAAAAACATCAATCACACAGACAAAATCATCAGCAAATTGACATCACA[T/G]
ATTCATCTGCAACTTCATAGAAACATCTAGAAATCATCCACAAATTTACATCCCAAAATCATCCACAGATTCAAAAAACATGTAAAAATCACCTACAAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.80% 9.20% 2.43% 0.55% NA
All Indica  2759 97.70% 0.90% 0.83% 0.54% NA
All Japonica  1512 66.90% 26.60% 5.89% 0.60% NA
Aus  269 99.30% 0.40% 0.00% 0.37% NA
Indica I  595 96.00% 2.20% 0.50% 1.34% NA
Indica II  465 97.60% 1.10% 0.86% 0.43% NA
Indica III  913 99.00% 0.10% 0.77% 0.11% NA
Indica Intermediate  786 97.60% 0.80% 1.15% 0.51% NA
Temperate Japonica  767 45.60% 47.30% 6.39% 0.65% NA
Tropical Japonica  504 90.30% 4.40% 4.96% 0.40% NA
Japonica Intermediate  241 85.90% 7.10% 6.22% 0.83% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 6.70% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221907189 A -> DEL N N silent_mutation Average:23.466; most accessible tissue: Callus, score: 46.599 N N N N
vg0221907189 A -> C LOC_Os02g36280.1 upstream_gene_variant ; 839.0bp to feature; MODIFIER silent_mutation Average:23.466; most accessible tissue: Callus, score: 46.599 N N N N
vg0221907189 A -> C LOC_Os02g36285.1 upstream_gene_variant ; 4245.0bp to feature; MODIFIER silent_mutation Average:23.466; most accessible tissue: Callus, score: 46.599 N N N N
vg0221907189 A -> C LOC_Os02g36280-LOC_Os02g36285 intergenic_region ; MODIFIER silent_mutation Average:23.466; most accessible tissue: Callus, score: 46.599 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221907189 NA 9.69E-16 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0221907189 NA 1.79E-11 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0221907189 9.67E-06 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189 NA 7.88E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189 NA 7.20E-07 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189 NA 8.65E-08 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189 NA 4.88E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189 4.53E-07 NA mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189 NA 3.49E-08 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189 NA 2.42E-06 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189 NA 1.78E-06 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189 NA 6.07E-06 mr1269_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189 NA 6.22E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189 1.21E-06 1.23E-07 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189 9.14E-06 1.79E-10 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189 8.29E-10 2.48E-13 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189 1.84E-07 4.91E-13 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189 NA 7.85E-09 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189 NA 4.54E-06 mr1576_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189 NA 5.08E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189 NA 9.92E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189 9.62E-09 NA mr1742_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189 2.12E-06 4.99E-12 mr1742_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189 8.23E-07 NA mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189 NA 2.46E-07 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189 NA 1.95E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189 NA 6.54E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189 NA 6.24E-08 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251