Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221907189:

Variant ID: vg0221907189 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21907189
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTGTAGGTGATTTTTACATGTTTTTTGAATCTGTGGATGATTTTGGGATGTAAATTTGTGGATGATTTCTAGATGTTTCTATGAAGTTGCAGATGAAT[A/C]
TGTGATGTCAATTTGCTGATGATTTTGTCTGTGTGATTGATGTTTTTGTCTGTGTGGTTGAGTTCGGTGCGAAATCAATATGAAAGTAGCAAAAAAAATA

Reverse complement sequence

TATTTTTTTTGCTACTTTCATATTGATTTCGCACCGAACTCAACCACACAGACAAAAACATCAATCACACAGACAAAATCATCAGCAAATTGACATCACA[T/G]
ATTCATCTGCAACTTCATAGAAACATCTAGAAATCATCCACAAATTTACATCCCAAAATCATCCACAGATTCAAAAAACATGTAAAAATCACCTACAAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.80%	9.20%	2.43%	0.55%	NA
All Indica	2759	97.70%	0.90%	0.83%	0.54%	NA
All Japonica	1512	66.90%	26.60%	5.89%	0.60%	NA
Aus	269	99.30%	0.40%	0.00%	0.37%	NA
Indica I	595	96.00%	2.20%	0.50%	1.34%	NA
Indica II	465	97.60%	1.10%	0.86%	0.43%	NA
Indica III	913	99.00%	0.10%	0.77%	0.11%	NA
Indica Intermediate	786	97.60%	0.80%	1.15%	0.51%	NA
Temperate Japonica	767	45.60%	47.30%	6.39%	0.65%	NA
Tropical Japonica	504	90.30%	4.40%	4.96%	0.40%	NA
Japonica Intermediate	241	85.90%	7.10%	6.22%	0.83%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	6.70%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221907189	A -> DEL	N	N	silent_mutation	Average:23.466; most accessible tissue: Callus, score: 46.599	N	N	N	N
vg0221907189	A -> C	LOC_Os02g36280.1	upstream_gene_variant ; 839.0bp to feature; MODIFIER	silent_mutation	Average:23.466; most accessible tissue: Callus, score: 46.599	N	N	N	N
vg0221907189	A -> C	LOC_Os02g36285.1	upstream_gene_variant ; 4245.0bp to feature; MODIFIER	silent_mutation	Average:23.466; most accessible tissue: Callus, score: 46.599	N	N	N	N
vg0221907189	A -> C	LOC_Os02g36280-LOC_Os02g36285	intergenic_region ; MODIFIER	silent_mutation	Average:23.466; most accessible tissue: Callus, score: 46.599	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221907189	NA	9.69E-16	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0221907189	NA	1.79E-11	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0221907189	9.67E-06	NA	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189	NA	7.88E-06	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189	NA	7.20E-07	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189	NA	8.65E-08	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189	NA	4.88E-08	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189	4.53E-07	NA	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189	NA	3.49E-08	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189	NA	2.42E-06	mr1043_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189	NA	1.78E-06	mr1051_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189	NA	6.07E-06	mr1269_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189	NA	6.22E-06	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189	1.21E-06	1.23E-07	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189	9.14E-06	1.79E-10	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189	8.29E-10	2.48E-13	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189	1.84E-07	4.91E-13	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189	NA	7.85E-09	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189	NA	4.54E-06	mr1576_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189	NA	5.08E-06	mr1588_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189	NA	9.92E-07	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189	9.62E-09	NA	mr1742_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189	2.12E-06	4.99E-12	mr1742_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189	8.23E-07	NA	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189	NA	2.46E-07	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189	NA	1.95E-08	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189	NA	6.54E-08	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221907189	NA	6.24E-08	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251