\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221902760:

Variant ID: vg0221902760 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21902760
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:


ATTGAGGTAGAATAAAACTTAAATTAATGTTGGAAGACACCTCTACTGTACATGCACACCCCTAATTTAATCCTAGTTGTTGAAGAACAGGAACAGGAAT[C/T]
CCTAATTATTTGTCTTATTCAGCTTGCAAGATTTTTACTAGCTACAACTTAGCACATGTAGCATCAGAATAAGCATGCAATAGTTTTTCACCATAACTTT

Reverse complement sequence

AAAGTTATGGTGAAAAACTATTGCATGCTTATTCTGATGCTACATGTGCTAAGTTGTAGCTAGTAAAAATCTTGCAAGCTGAATAAGACAAATAATTAGG[G/A]
ATTCCTGTTCCTGTTCTTCAACAACTAGGATTAAATTAGGGGTGTGCATGTACAGTAGAGGTGTCTTCCAACATTAATTTAAGTTTTATTCTACCTCAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.70% 5.10% 7.38% 8.82% NA
All Indica  2759 80.70% 8.40% 7.90% 3.04% NA
All Japonica  1512 72.60% 0.30% 6.08% 21.10% NA
Aus  269 96.30% 0.70% 2.23% 0.74% NA
Indica I  595 75.60% 2.20% 18.66% 3.53% NA
Indica II  465 88.20% 4.30% 4.09% 3.44% NA
Indica III  913 79.10% 15.60% 3.07% 2.30% NA
Indica Intermediate  786 81.90% 7.10% 7.63% 3.31% NA
Temperate Japonica  767 66.60% 0.00% 2.35% 31.03% NA
Tropical Japonica  504 84.70% 0.80% 6.94% 7.54% NA
Japonica Intermediate  241 66.00% 0.00% 16.18% 17.84% NA
VI/Aromatic  96 62.50% 0.00% 29.17% 8.33% NA
Intermediate  90 86.70% 3.30% 5.56% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221902760 C -> T LOC_Os02g36264.1 upstream_gene_variant ; 3530.0bp to feature; MODIFIER silent_mutation Average:50.977; most accessible tissue: Callus, score: 74.552 N N N N
vg0221902760 C -> T LOC_Os02g36280.1 downstream_gene_variant ; 1594.0bp to feature; MODIFIER silent_mutation Average:50.977; most accessible tissue: Callus, score: 74.552 N N N N
vg0221902760 C -> T LOC_Os02g36264-LOC_Os02g36280 intergenic_region ; MODIFIER silent_mutation Average:50.977; most accessible tissue: Callus, score: 74.552 N N N N
vg0221902760 C -> DEL N N silent_mutation Average:50.977; most accessible tissue: Callus, score: 74.552 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221902760 NA 1.24E-07 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221902760 NA 2.37E-07 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221902760 5.11E-06 4.30E-09 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221902760 2.39E-08 2.39E-08 mr1900 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221902760 NA 1.80E-07 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221902760 NA 6.58E-07 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221902760 NA 3.25E-08 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221902760 NA 7.13E-07 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251