Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221902760:

Variant ID: vg0221902760 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21902760
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

ATTGAGGTAGAATAAAACTTAAATTAATGTTGGAAGACACCTCTACTGTACATGCACACCCCTAATTTAATCCTAGTTGTTGAAGAACAGGAACAGGAAT[C/T]
CCTAATTATTTGTCTTATTCAGCTTGCAAGATTTTTACTAGCTACAACTTAGCACATGTAGCATCAGAATAAGCATGCAATAGTTTTTCACCATAACTTT

Reverse complement sequence

AAAGTTATGGTGAAAAACTATTGCATGCTTATTCTGATGCTACATGTGCTAAGTTGTAGCTAGTAAAAATCTTGCAAGCTGAATAAGACAAATAATTAGG[G/A]
ATTCCTGTTCCTGTTCTTCAACAACTAGGATTAAATTAGGGGTGTGCATGTACAGTAGAGGTGTCTTCCAACATTAATTTAAGTTTTATTCTACCTCAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.70%	5.10%	7.38%	8.82%	NA
All Indica	2759	80.70%	8.40%	7.90%	3.04%	NA
All Japonica	1512	72.60%	0.30%	6.08%	21.10%	NA
Aus	269	96.30%	0.70%	2.23%	0.74%	NA
Indica I	595	75.60%	2.20%	18.66%	3.53%	NA
Indica II	465	88.20%	4.30%	4.09%	3.44%	NA
Indica III	913	79.10%	15.60%	3.07%	2.30%	NA
Indica Intermediate	786	81.90%	7.10%	7.63%	3.31%	NA
Temperate Japonica	767	66.60%	0.00%	2.35%	31.03%	NA
Tropical Japonica	504	84.70%	0.80%	6.94%	7.54%	NA
Japonica Intermediate	241	66.00%	0.00%	16.18%	17.84%	NA
VI/Aromatic	96	62.50%	0.00%	29.17%	8.33%	NA
Intermediate	90	86.70%	3.30%	5.56%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221902760	C -> T	LOC_Os02g36264.1	upstream_gene_variant ; 3530.0bp to feature; MODIFIER	silent_mutation	Average:50.977; most accessible tissue: Callus, score: 74.552	N	N	N	N
vg0221902760	C -> T	LOC_Os02g36280.1	downstream_gene_variant ; 1594.0bp to feature; MODIFIER	silent_mutation	Average:50.977; most accessible tissue: Callus, score: 74.552	N	N	N	N
vg0221902760	C -> T	LOC_Os02g36264-LOC_Os02g36280	intergenic_region ; MODIFIER	silent_mutation	Average:50.977; most accessible tissue: Callus, score: 74.552	N	N	N	N
vg0221902760	C -> DEL	N	N	silent_mutation	Average:50.977; most accessible tissue: Callus, score: 74.552	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221902760	NA	1.24E-07	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221902760	NA	2.37E-07	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221902760	5.11E-06	4.30E-09	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221902760	2.39E-08	2.39E-08	mr1900	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221902760	NA	1.80E-07	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221902760	NA	6.58E-07	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221902760	NA	3.25E-08	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221902760	NA	7.13E-07	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251