\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221882859:

Variant ID: vg0221882859 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21882859
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTAAGTGAAAATCAAGGGGTAGATTTTTTGCTTTTTTCTTAGAATTTCTAGGATTTTCTCTATTTTATTAGAGCGCCATTTGGCGGCTTAAGAGCGTTT[G/A]
TAGGAAGTCTCATGGACTTTTAGTATATAATAGATAGATAGATAGATAGATAGATAGATAGATAGAAGATAGATAGATAGATAGATAGATAGATAGATAG

Reverse complement sequence

CTATCTATCTATCTATCTATCTATCTATCTATCTTCTATCTATCTATCTATCTATCTATCTATCTATCTATTATATACTAAAAGTCCATGAGACTTCCTA[C/T]
AAACGCTCTTAAGCCGCCAAATGGCGCTCTAATAAAATAGAGAAAATCCTAGAAATTCTAAGAAAAAAGCAAAAAATCTACCCCTTGATTTTCACTTAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.90% 2.30% 7.49% 58.27% NA
All Indica  2759 3.80% 0.00% 10.04% 86.12% NA
All Japonica  1512 83.10% 7.30% 2.45% 7.14% NA
Aus  269 4.50% 0.00% 12.27% 83.27% NA
Indica I  595 4.50% 0.00% 6.89% 88.57% NA
Indica II  465 2.20% 0.00% 6.02% 91.83% NA
Indica III  913 3.10% 0.00% 13.58% 83.35% NA
Indica Intermediate  786 5.20% 0.00% 10.69% 84.10% NA
Temperate Japonica  767 84.60% 11.20% 3.13% 1.04% NA
Tropical Japonica  504 80.80% 0.00% 1.79% 17.46% NA
Japonica Intermediate  241 83.40% 10.00% 1.66% 4.98% NA
VI/Aromatic  96 91.70% 0.00% 1.04% 7.29% NA
Intermediate  90 48.90% 1.10% 6.67% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221882859 G -> A LOC_Os02g36250.1 downstream_gene_variant ; 2220.0bp to feature; MODIFIER silent_mutation Average:45.75; most accessible tissue: Minghui63 root, score: 77.009 N N N N
vg0221882859 G -> A LOC_Os02g36264.1 downstream_gene_variant ; 3451.0bp to feature; MODIFIER silent_mutation Average:45.75; most accessible tissue: Minghui63 root, score: 77.009 N N N N
vg0221882859 G -> A LOC_Os02g36230-LOC_Os02g36250 intergenic_region ; MODIFIER silent_mutation Average:45.75; most accessible tissue: Minghui63 root, score: 77.009 N N N N
vg0221882859 G -> DEL N N silent_mutation Average:45.75; most accessible tissue: Minghui63 root, score: 77.009 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221882859 1.88E-07 1.88E-07 mr1036_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251