\
| Variant ID: vg0221882859 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21882859 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTAAGTGAAAATCAAGGGGTAGATTTTTTGCTTTTTTCTTAGAATTTCTAGGATTTTCTCTATTTTATTAGAGCGCCATTTGGCGGCTTAAGAGCGTTT[G/A]
TAGGAAGTCTCATGGACTTTTAGTATATAATAGATAGATAGATAGATAGATAGATAGATAGATAGAAGATAGATAGATAGATAGATAGATAGATAGATAG
CTATCTATCTATCTATCTATCTATCTATCTATCTTCTATCTATCTATCTATCTATCTATCTATCTATCTATTATATACTAAAAGTCCATGAGACTTCCTA[C/T]
AAACGCTCTTAAGCCGCCAAATGGCGCTCTAATAAAATAGAGAAAATCCTAGAAATTCTAAGAAAAAAGCAAAAAATCTACCCCTTGATTTTCACTTAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.90% | 2.30% | 7.49% | 58.27% | NA |
| All Indica | 2759 | 3.80% | 0.00% | 10.04% | 86.12% | NA |
| All Japonica | 1512 | 83.10% | 7.30% | 2.45% | 7.14% | NA |
| Aus | 269 | 4.50% | 0.00% | 12.27% | 83.27% | NA |
| Indica I | 595 | 4.50% | 0.00% | 6.89% | 88.57% | NA |
| Indica II | 465 | 2.20% | 0.00% | 6.02% | 91.83% | NA |
| Indica III | 913 | 3.10% | 0.00% | 13.58% | 83.35% | NA |
| Indica Intermediate | 786 | 5.20% | 0.00% | 10.69% | 84.10% | NA |
| Temperate Japonica | 767 | 84.60% | 11.20% | 3.13% | 1.04% | NA |
| Tropical Japonica | 504 | 80.80% | 0.00% | 1.79% | 17.46% | NA |
| Japonica Intermediate | 241 | 83.40% | 10.00% | 1.66% | 4.98% | NA |
| VI/Aromatic | 96 | 91.70% | 0.00% | 1.04% | 7.29% | NA |
| Intermediate | 90 | 48.90% | 1.10% | 6.67% | 43.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221882859 | G -> A | LOC_Os02g36250.1 | downstream_gene_variant ; 2220.0bp to feature; MODIFIER | silent_mutation | Average:45.75; most accessible tissue: Minghui63 root, score: 77.009 | N | N | N | N |
| vg0221882859 | G -> A | LOC_Os02g36264.1 | downstream_gene_variant ; 3451.0bp to feature; MODIFIER | silent_mutation | Average:45.75; most accessible tissue: Minghui63 root, score: 77.009 | N | N | N | N |
| vg0221882859 | G -> A | LOC_Os02g36230-LOC_Os02g36250 | intergenic_region ; MODIFIER | silent_mutation | Average:45.75; most accessible tissue: Minghui63 root, score: 77.009 | N | N | N | N |
| vg0221882859 | G -> DEL | N | N | silent_mutation | Average:45.75; most accessible tissue: Minghui63 root, score: 77.009 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221882859 | 1.88E-07 | 1.88E-07 | mr1036_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |