Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221882859:

Variant ID: vg0221882859 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21882859
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTAAGTGAAAATCAAGGGGTAGATTTTTTGCTTTTTTCTTAGAATTTCTAGGATTTTCTCTATTTTATTAGAGCGCCATTTGGCGGCTTAAGAGCGTTT[G/A]
TAGGAAGTCTCATGGACTTTTAGTATATAATAGATAGATAGATAGATAGATAGATAGATAGATAGAAGATAGATAGATAGATAGATAGATAGATAGATAG

Reverse complement sequence

CTATCTATCTATCTATCTATCTATCTATCTATCTTCTATCTATCTATCTATCTATCTATCTATCTATCTATTATATACTAAAAGTCCATGAGACTTCCTA[C/T]
AAACGCTCTTAAGCCGCCAAATGGCGCTCTAATAAAATAGAGAAAATCCTAGAAATTCTAAGAAAAAAGCAAAAAATCTACCCCTTGATTTTCACTTAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.90%	2.30%	7.49%	58.27%	NA
All Indica	2759	3.80%	0.00%	10.04%	86.12%	NA
All Japonica	1512	83.10%	7.30%	2.45%	7.14%	NA
Aus	269	4.50%	0.00%	12.27%	83.27%	NA
Indica I	595	4.50%	0.00%	6.89%	88.57%	NA
Indica II	465	2.20%	0.00%	6.02%	91.83%	NA
Indica III	913	3.10%	0.00%	13.58%	83.35%	NA
Indica Intermediate	786	5.20%	0.00%	10.69%	84.10%	NA
Temperate Japonica	767	84.60%	11.20%	3.13%	1.04%	NA
Tropical Japonica	504	80.80%	0.00%	1.79%	17.46%	NA
Japonica Intermediate	241	83.40%	10.00%	1.66%	4.98%	NA
VI/Aromatic	96	91.70%	0.00%	1.04%	7.29%	NA
Intermediate	90	48.90%	1.10%	6.67%	43.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221882859	G -> A	LOC_Os02g36250.1	downstream_gene_variant ; 2220.0bp to feature; MODIFIER	silent_mutation	Average:45.75; most accessible tissue: Minghui63 root, score: 77.009	N	N	N	N
vg0221882859	G -> A	LOC_Os02g36264.1	downstream_gene_variant ; 3451.0bp to feature; MODIFIER	silent_mutation	Average:45.75; most accessible tissue: Minghui63 root, score: 77.009	N	N	N	N
vg0221882859	G -> A	LOC_Os02g36230-LOC_Os02g36250	intergenic_region ; MODIFIER	silent_mutation	Average:45.75; most accessible tissue: Minghui63 root, score: 77.009	N	N	N	N
vg0221882859	G -> DEL	N	N	silent_mutation	Average:45.75; most accessible tissue: Minghui63 root, score: 77.009	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221882859	1.88E-07	1.88E-07	mr1036_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251