\
| Variant ID: vg0221873638 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21873638 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ACGCGAGGTGGACCCGGCCCACCGGTTCCCCTCCCTCTCTCCCCGCGCGTGCCTTTGGGCCGCCTTCTCGGGCCGGCCGGCCCATTTAGCTCGGCCGAGC[C/T]
GCCCTTTTCTCTCGGGCCGCACCCTAGCCGCCTGAGGGAAGTCTATTTCCCCTCCCTCTTTCTTTTCTTTTTTCAAAAGGGTTTAATTAAATCCTTTTTC
GAAAAAGGATTTAATTAAACCCTTTTGAAAAAAGAAAAGAAAGAGGGAGGGGAAATAGACTTCCCTCAGGCGGCTAGGGTGCGGCCCGAGAGAAAAGGGC[G/A]
GCTCGGCCGAGCTAAATGGGCCGGCCGGCCCGAGAAGGCGGCCCAAAGGCACGCGCGGGGAGAGAGGGAGGGGAACCGGTGGGCCGGGTCCACCTCGCGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.10% | 33.70% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 97.50% | 2.40% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 7.90% | 92.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 98.90% | 0.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.10% | 1.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.30% | 4.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 19.40% | 80.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.40% | 94.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 8.30% | 90.60% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 51.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221873638 | C -> T | LOC_Os02g36230.1 | downstream_gene_variant ; 4058.0bp to feature; MODIFIER | silent_mutation | Average:32.08; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 | N | N | N | N |
| vg0221873638 | C -> T | LOC_Os02g36230-LOC_Os02g36250 | intergenic_region ; MODIFIER | silent_mutation | Average:32.08; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221873638 | NA | 6.87E-07 | mr1305 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221873638 | NA | 2.22E-06 | mr1586 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221873638 | NA | 9.71E-11 | mr1714 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221873638 | NA | 3.53E-06 | mr1246_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221873638 | 4.97E-06 | 6.44E-07 | mr1305_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221873638 | NA | 2.39E-16 | mr1592_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221873638 | NA | 1.93E-10 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221873638 | NA | 5.49E-09 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221873638 | NA | 1.24E-06 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221873638 | NA | 4.05E-08 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221873638 | NA | 2.56E-09 | mr1947_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |