\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221872725:

Variant ID: vg0221872725 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21872725
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCCGTTTGTCGCCAAAGCACCGGGAGAGCCAGTGCGTGCGAAGGACGCGTGAAGGGGACTCCGGGCGCTCGTCTTCTTCCTCTTCCCCGGCCCGAGGCC[G/A]
GAGAGATCACTCCCGTGCCGTCGGCCTCTCGTCACAGCGCCCCGTCTCGTCTCGGTAGAACACCTCCCCGTTCTCCCTCCTCACTCTTCCTCCTTCCGCT

Reverse complement sequence

AGCGGAAGGAGGAAGAGTGAGGAGGGAGAACGGGGAGGTGTTCTACCGAGACGAGACGGGGCGCTGTGACGAGAGGCCGACGGCACGGGAGTGATCTCTC[C/T]
GGCCTCGGGCCGGGGAAGAGGAAGAAGACGAGCGCCCGGAGTCCCCTTCACGCGTCCTTCGCACGCACTGGCTCTCCCGGTGCTTTGGCGACAAACGGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.20% 24.80% 0.04% 0.00% NA
All Indica  2759 98.20% 1.80% 0.04% 0.00% NA
All Japonica  1512 33.70% 66.20% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 98.40% 1.60% 0.00% 0.00% NA
Indica Intermediate  786 95.90% 3.90% 0.13% 0.00% NA
Temperate Japonica  767 48.90% 51.10% 0.00% 0.00% NA
Tropical Japonica  504 20.60% 79.40% 0.00% 0.00% NA
Japonica Intermediate  241 12.90% 86.70% 0.41% 0.00% NA
VI/Aromatic  96 10.40% 89.60% 0.00% 0.00% NA
Intermediate  90 63.30% 36.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221872725 G -> A LOC_Os02g36230.1 downstream_gene_variant ; 3145.0bp to feature; MODIFIER silent_mutation Average:33.151; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0221872725 G -> A LOC_Os02g36230-LOC_Os02g36250 intergenic_region ; MODIFIER silent_mutation Average:33.151; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221872725 NA 5.59E-13 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872725 NA 1.50E-07 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872725 4.05E-07 4.05E-07 mr1186_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872725 6.01E-06 6.00E-06 mr1245_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872725 NA 8.08E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872725 NA 2.88E-07 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872725 5.08E-06 5.08E-06 mr1616_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872725 3.40E-08 NA mr1648_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872725 2.29E-07 2.29E-07 mr1648_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872725 5.66E-06 5.66E-06 mr1697_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872725 NA 1.71E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872725 NA 8.15E-06 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872725 NA 9.30E-11 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872725 NA 1.03E-07 mr1977_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251