Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221872725:

Variant ID: vg0221872725 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21872725
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGCCGTTTGTCGCCAAAGCACCGGGAGAGCCAGTGCGTGCGAAGGACGCGTGAAGGGGACTCCGGGCGCTCGTCTTCTTCCTCTTCCCCGGCCCGAGGCC[G/A]
GAGAGATCACTCCCGTGCCGTCGGCCTCTCGTCACAGCGCCCCGTCTCGTCTCGGTAGAACACCTCCCCGTTCTCCCTCCTCACTCTTCCTCCTTCCGCT

Reverse complement sequence

AGCGGAAGGAGGAAGAGTGAGGAGGGAGAACGGGGAGGTGTTCTACCGAGACGAGACGGGGCGCTGTGACGAGAGGCCGACGGCACGGGAGTGATCTCTC[C/T]
GGCCTCGGGCCGGGGAAGAGGAAGAAGACGAGCGCCCGGAGTCCCCTTCACGCGTCCTTCGCACGCACTGGCTCTCCCGGTGCTTTGGCGACAAACGGCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.20%	24.80%	0.04%	0.00%	NA
All Indica	2759	98.20%	1.80%	0.04%	0.00%	NA
All Japonica	1512	33.70%	66.20%	0.07%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	98.40%	1.60%	0.00%	0.00%	NA
Indica Intermediate	786	95.90%	3.90%	0.13%	0.00%	NA
Temperate Japonica	767	48.90%	51.10%	0.00%	0.00%	NA
Tropical Japonica	504	20.60%	79.40%	0.00%	0.00%	NA
Japonica Intermediate	241	12.90%	86.70%	0.41%	0.00%	NA
VI/Aromatic	96	10.40%	89.60%	0.00%	0.00%	NA
Intermediate	90	63.30%	36.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221872725	G -> A	LOC_Os02g36230.1	downstream_gene_variant ; 3145.0bp to feature; MODIFIER	silent_mutation	Average:33.151; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0221872725	G -> A	LOC_Os02g36230-LOC_Os02g36250	intergenic_region ; MODIFIER	silent_mutation	Average:33.151; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221872725	NA	5.59E-13	mr1205	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872725	NA	1.50E-07	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872725	4.05E-07	4.05E-07	mr1186_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872725	6.01E-06	6.00E-06	mr1245_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872725	NA	8.08E-06	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872725	NA	2.88E-07	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872725	5.08E-06	5.08E-06	mr1616_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872725	3.40E-08	NA	mr1648_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872725	2.29E-07	2.29E-07	mr1648_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872725	5.66E-06	5.66E-06	mr1697_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872725	NA	1.71E-09	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872725	NA	8.15E-06	mr1851_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872725	NA	9.30E-11	mr1947_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872725	NA	1.03E-07	mr1977_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251