\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221872696:

Variant ID: vg0221872696 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21872696
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCATCGTCGCTCCGCCCTGCTTGCACCTCCGCCGTTTGTCGCCAAAGCACCGGGAGAGCCAGTGCGTGCGAAGGACGCGTGAAGGGGACTCCGGGCGCTC[G/A,C]
TCTTCTTCCTCTTCCCCGGCCCGAGGCCGGAGAGATCACTCCCGTGCCGTCGGCCTCTCGTCACAGCGCCCCGTCTCGTCTCGGTAGAACACCTCCCCGT

Reverse complement sequence

ACGGGGAGGTGTTCTACCGAGACGAGACGGGGCGCTGTGACGAGAGGCCGACGGCACGGGAGTGATCTCTCCGGCCTCGGGCCGGGGAAGAGGAAGAAGA[C/T,G]
GAGCGCCCGGAGTCCCCTTCACGCGTCCTTCGCACGCACTGGCTCTCCCGGTGCTTTGGCGACAAACGGCGGAGGTGCAAGCAGGGCGGAGCGACGATGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.00% 24.80% 0.13% 0.00% C: 0.02%
All Indica  2759 98.10% 1.80% 0.11% 0.00% C: 0.04%
All Japonica  1512 33.50% 66.30% 0.20% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.40% 0.40% 0.00% 0.00% C: 0.22%
Indica III  913 98.20% 1.60% 0.11% 0.00% NA
Indica Intermediate  786 95.80% 3.90% 0.25% 0.00% NA
Temperate Japonica  767 48.80% 51.20% 0.00% 0.00% NA
Tropical Japonica  504 20.60% 79.40% 0.00% 0.00% NA
Japonica Intermediate  241 12.00% 86.70% 1.24% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 63.30% 36.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221872696 G -> A LOC_Os02g36230.1 downstream_gene_variant ; 3116.0bp to feature; MODIFIER silent_mutation Average:33.931; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0221872696 G -> A LOC_Os02g36230-LOC_Os02g36250 intergenic_region ; MODIFIER silent_mutation Average:33.931; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0221872696 G -> C LOC_Os02g36230.1 downstream_gene_variant ; 3116.0bp to feature; MODIFIER silent_mutation Average:33.931; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0221872696 G -> C LOC_Os02g36230-LOC_Os02g36250 intergenic_region ; MODIFIER silent_mutation Average:33.931; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221872696 NA 1.83E-12 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872696 NA 3.30E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872696 4.97E-07 4.97E-07 mr1186_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872696 2.37E-06 2.37E-06 mr1245_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872696 NA 9.39E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872696 NA 4.15E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872696 NA 7.04E-06 mr1380_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872696 1.78E-06 NA mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872696 3.12E-06 NA mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872696 NA 1.36E-06 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872696 NA 7.99E-08 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872696 1.16E-06 NA mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872696 1.46E-06 NA mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872696 1.24E-06 1.24E-06 mr1648_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872696 3.93E-06 NA mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872696 NA 6.09E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872696 NA 3.05E-10 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221872696 NA 9.63E-08 mr1977_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251