\
| Variant ID: vg0221870781 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21870781 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTCCCTCTGTATTTTAATACATGATGCTGTCGATTTTTTTTATCAATATTTAACTATTCATTTTATTTATAAAAATATGCAATTATCATTTATTTTATGT[G/A]
ACTTTATCATCAAATGTTTTTTAAACATAACATAAATATTTTAATATTTGTATAAAACTTTTGAAAAAGACGAATGGTCAAACATTGGTCAAAAAGTGAC
GTCACTTTTTGACCAATGTTTGACCATTCGTCTTTTTCAAAAGTTTTATACAAATATTAAAATATTTATGTTATGTTTAAAAAACATTTGATGATAAAGT[C/T]
ACATAAAATAAATGATAATTGCATATTTTTATAAATAAAATGAATAGTTAAATATTGATAAAAAAAATCGACAGCATCATGTATTAAAATACAGAGGGAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.50% | 24.80% | 0.72% | 0.02% | NA |
| All Indica | 2759 | 97.90% | 1.30% | 0.76% | 0.04% | NA |
| All Japonica | 1512 | 32.90% | 66.90% | 0.20% | 0.00% | NA |
| Aus | 269 | 97.80% | 0.40% | 1.86% | 0.00% | NA |
| Indica I | 595 | 98.80% | 0.20% | 1.01% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.40% | 1.40% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 95.90% | 2.30% | 1.65% | 0.13% | NA |
| Temperate Japonica | 767 | 47.80% | 51.90% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 20.40% | 79.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 11.60% | 88.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 8.30% | 90.60% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 40.00% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221870781 | G -> A | LOC_Os02g36230.1 | downstream_gene_variant ; 1201.0bp to feature; MODIFIER | silent_mutation | Average:27.241; most accessible tissue: Callus, score: 48.728 | N | N | N | N |
| vg0221870781 | G -> A | LOC_Os02g36230-LOC_Os02g36250 | intergenic_region ; MODIFIER | silent_mutation | Average:27.241; most accessible tissue: Callus, score: 48.728 | N | N | N | N |
| vg0221870781 | G -> DEL | N | N | silent_mutation | Average:27.241; most accessible tissue: Callus, score: 48.728 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221870781 | 2.19E-06 | NA | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221870781 | 5.05E-06 | 6.65E-06 | mr1502 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221870781 | 1.05E-06 | 2.11E-07 | mr1502 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221870781 | 3.03E-06 | NA | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221870781 | 2.62E-06 | NA | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221870781 | NA | 4.61E-10 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221870781 | NA | 9.92E-07 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221870781 | NA | 4.65E-09 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221870781 | 1.52E-07 | NA | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221870781 | 5.65E-06 | NA | mr1742_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |