\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221870781:

Variant ID: vg0221870781 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21870781
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCCCTCTGTATTTTAATACATGATGCTGTCGATTTTTTTTATCAATATTTAACTATTCATTTTATTTATAAAAATATGCAATTATCATTTATTTTATGT[G/A]
ACTTTATCATCAAATGTTTTTTAAACATAACATAAATATTTTAATATTTGTATAAAACTTTTGAAAAAGACGAATGGTCAAACATTGGTCAAAAAGTGAC

Reverse complement sequence

GTCACTTTTTGACCAATGTTTGACCATTCGTCTTTTTCAAAAGTTTTATACAAATATTAAAATATTTATGTTATGTTTAAAAAACATTTGATGATAAAGT[C/T]
ACATAAAATAAATGATAATTGCATATTTTTATAAATAAAATGAATAGTTAAATATTGATAAAAAAAATCGACAGCATCATGTATTAAAATACAGAGGGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.50% 24.80% 0.72% 0.02% NA
All Indica  2759 97.90% 1.30% 0.76% 0.04% NA
All Japonica  1512 32.90% 66.90% 0.20% 0.00% NA
Aus  269 97.80% 0.40% 1.86% 0.00% NA
Indica I  595 98.80% 0.20% 1.01% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 98.40% 1.40% 0.22% 0.00% NA
Indica Intermediate  786 95.90% 2.30% 1.65% 0.13% NA
Temperate Japonica  767 47.80% 51.90% 0.26% 0.00% NA
Tropical Japonica  504 20.40% 79.40% 0.20% 0.00% NA
Japonica Intermediate  241 11.60% 88.40% 0.00% 0.00% NA
VI/Aromatic  96 8.30% 90.60% 1.04% 0.00% NA
Intermediate  90 55.60% 40.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221870781 G -> A LOC_Os02g36230.1 downstream_gene_variant ; 1201.0bp to feature; MODIFIER silent_mutation Average:27.241; most accessible tissue: Callus, score: 48.728 N N N N
vg0221870781 G -> A LOC_Os02g36230-LOC_Os02g36250 intergenic_region ; MODIFIER silent_mutation Average:27.241; most accessible tissue: Callus, score: 48.728 N N N N
vg0221870781 G -> DEL N N silent_mutation Average:27.241; most accessible tissue: Callus, score: 48.728 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221870781 2.19E-06 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221870781 5.05E-06 6.65E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221870781 1.05E-06 2.11E-07 mr1502 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221870781 3.03E-06 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221870781 2.62E-06 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221870781 NA 4.61E-10 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221870781 NA 9.92E-07 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221870781 NA 4.65E-09 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221870781 1.52E-07 NA mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221870781 5.65E-06 NA mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251