\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221866544:

Variant ID: vg0221866544 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 21866544
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTTTTTAATAAATATTTAATCTTTCATCTTATTTAAAAAAATTTATGTAATTATAATTTATTTTATTGTGACTTGATTTATCATCAAATATTCTTTAAG[C/T]
ATGACATAAGTATATTTATATTTGCATAAAATTTTTTAATAAGACGAGTGGTCAGATGTTGGTTAAAAAGTCAACAGTGTCATACTTTTTAAAATATGGA

Reverse complement sequence

TCCATATTTTAAAAAGTATGACACTGTTGACTTTTTAACCAACATCTGACCACTCGTCTTATTAAAAAATTTTATGCAAATATAAATATACTTATGTCAT[G/A]
CTTAAAGAATATTTGATGATAAATCAAGTCACAATAAAATAAATTATAATTACATAAATTTTTTTAAATAAGATGAAAGATTAAATATTTATTAAAAAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.30% 24.90% 16.40% 5.33% NA
All Indica  2759 63.20% 1.80% 26.06% 8.92% NA
All Japonica  1512 32.30% 66.60% 0.93% 0.20% NA
Aus  269 88.10% 0.70% 10.41% 0.74% NA
Indica I  595 63.40% 0.20% 26.39% 10.08% NA
Indica II  465 59.60% 0.40% 34.62% 5.38% NA
Indica III  913 64.30% 1.50% 25.19% 8.98% NA
Indica Intermediate  786 64.10% 4.10% 21.76% 10.05% NA
Temperate Japonica  767 47.60% 52.00% 0.39% 0.00% NA
Tropical Japonica  504 19.00% 79.00% 1.59% 0.40% NA
Japonica Intermediate  241 11.20% 87.10% 1.24% 0.41% NA
VI/Aromatic  96 8.30% 90.60% 1.04% 0.00% NA
Intermediate  90 47.80% 36.70% 14.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221866544 C -> T LOC_Os02g36220.1 upstream_gene_variant ; 2952.0bp to feature; MODIFIER silent_mutation Average:80.036; most accessible tissue: Minghui63 panicle, score: 89.702 N N N N
vg0221866544 C -> T LOC_Os02g36230.1 upstream_gene_variant ; 938.0bp to feature; MODIFIER silent_mutation Average:80.036; most accessible tissue: Minghui63 panicle, score: 89.702 N N N N
vg0221866544 C -> T LOC_Os02g36220.2 upstream_gene_variant ; 2952.0bp to feature; MODIFIER silent_mutation Average:80.036; most accessible tissue: Minghui63 panicle, score: 89.702 N N N N
vg0221866544 C -> T LOC_Os02g36220-LOC_Os02g36230 intergenic_region ; MODIFIER silent_mutation Average:80.036; most accessible tissue: Minghui63 panicle, score: 89.702 N N N N
vg0221866544 C -> DEL N N silent_mutation Average:80.036; most accessible tissue: Minghui63 panicle, score: 89.702 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0221866544 C T 0.03 0.01 0.0 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221866544 NA 2.58E-12 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221866544 1.73E-06 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221866544 2.05E-06 NA mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221866544 NA 1.43E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221866544 7.32E-06 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221866544 NA 2.80E-12 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221866544 NA 3.58E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221866544 1.51E-07 3.91E-21 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221866544 6.19E-06 NA mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221866544 NA 7.30E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221866544 2.94E-06 NA mr1502_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221866544 3.01E-09 NA mr1543_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221866544 7.16E-08 NA mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221866544 NA 1.25E-07 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221866544 2.87E-08 NA mr1742_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221866544 6.03E-06 NA mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221866544 3.21E-08 NA mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221866544 NA 4.55E-09 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221866544 NA 2.92E-06 mr1977_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251