\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221862609:

Variant ID: vg0221862609 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 21862609
Reference Allele: GAlternative Allele: A,GTGTTTGATACTCGGGGT,C
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTAAGCCTGTGGGATAGACGGTGGGTTGTTCTACTAATATGAAATATTAACTGTGTACTTGTGTTATACTCCATCCGTCCCATAGTATAGCAACTTAGG[G/A,GTGTTTGATACTCGGGGT,C]
TGGGAGGGAGTACTATCTTCCAAGTCAAGTTAAACGATTTGATTATTGCTAGCTAGCATTCAGCACGTGCGTACGTACAGTACGCCCTTGAGGACTTGGG

Reverse complement sequence

CCCAAGTCCTCAAGGGCGTACTGTACGTACGCACGTGCTGAATGCTAGCTAGCAATAATCAAATCGTTTAACTTGACTTGGAAGATAGTACTCCCTCCCA[C/T,ACCCCGAGTATCAAACAC,G]
CCTAAGTTGCTATACTATGGGACGGATGGAGTATAACACAAGTACACAGTTAATATTTCATATTAGTAGAACAACCCACCGTCTATCCCACAGGCTTAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.00% 10.00% 7.70% 13.14% C: 1.33%; GTGTTTGATACTCGGGGT: 0.83%
All Indica  2759 97.60% 1.30% 0.18% 0.76% GTGTTTGATACTCGGGGT: 0.07%; C: 0.07%
All Japonica  1512 9.00% 28.20% 22.02% 35.19% C: 3.70%; GTGTTTGATACTCGGGGT: 1.85%
Aus  269 99.30% 0.40% 0.00% 0.37% NA
Indica I  595 98.50% 1.30% 0.00% 0.17% NA
Indica II  465 98.90% 0.60% 0.22% 0.00% GTGTTTGATACTCGGGGT: 0.22%
Indica III  913 98.40% 0.30% 0.33% 0.77% GTGTTTGATACTCGGGGT: 0.11%; C: 0.11%
Indica Intermediate  786 95.40% 2.70% 0.13% 1.65% C: 0.13%
Temperate Japonica  767 1.60% 52.70% 26.21% 16.69% C: 1.56%; GTGTTTGATACTCGGGGT: 1.30%
Tropical Japonica  504 21.00% 1.20% 14.09% 55.16% C: 6.55%; GTGTTTGATACTCGGGGT: 1.98%
Japonica Intermediate  241 7.50% 7.10% 25.31% 52.28% C: 4.56%; GTGTTTGATACTCGGGGT: 3.32%
VI/Aromatic  96 15.60% 0.00% 16.67% 56.25% GTGTTTGATACTCGGGGT: 7.29%; C: 4.17%
Intermediate  90 58.90% 12.20% 11.11% 14.44% GTGTTTGATACTCGGGGT: 2.22%; C: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0221862609 G -> A LOC_Os02g36230.1 upstream_gene_variant ; 4873.0bp to feature; MODIFIER silent_mutation Average:61.982; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0221862609 G -> A LOC_Os02g36220.1 intron_variant ; MODIFIER silent_mutation Average:61.982; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0221862609 G -> A LOC_Os02g36220.2 intron_variant ; MODIFIER silent_mutation Average:61.982; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0221862609 G -> DEL N N silent_mutation Average:61.982; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0221862609 G -> GTGTTTGATACTCGGGGT LOC_Os02g36230.1 upstream_gene_variant ; 4872.0bp to feature; MODIFIER silent_mutation Average:61.982; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0221862609 G -> GTGTTTGATACTCGGGGT LOC_Os02g36220.1 intron_variant ; MODIFIER silent_mutation Average:61.982; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0221862609 G -> GTGTTTGATACTCGGGGT LOC_Os02g36220.2 intron_variant ; MODIFIER silent_mutation Average:61.982; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0221862609 G -> C LOC_Os02g36230.1 upstream_gene_variant ; 4873.0bp to feature; MODIFIER silent_mutation Average:61.982; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0221862609 G -> C LOC_Os02g36220.1 intron_variant ; MODIFIER silent_mutation Average:61.982; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0221862609 G -> C LOC_Os02g36220.2 intron_variant ; MODIFIER silent_mutation Average:61.982; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0221862609 G A -0.02 -0.02 -0.01 -0.04 -0.03 -0.02
vg0221862609 G C 0.05 -0.02 0.0 -0.01 -0.01 0.0
vg0221862609 G GTGTT* -0.15 -0.05 -0.02 -0.17 -0.14 -0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0221862609 2.18E-07 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221862609 2.62E-06 NA mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221862609 6.01E-07 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221862609 7.61E-06 NA mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221862609 NA 2.20E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221862609 NA 6.01E-08 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221862609 2.24E-07 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221862609 3.71E-06 NA mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221862609 2.02E-07 NA mr1042_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221862609 NA 2.01E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221862609 6.17E-06 NA mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221862609 NA 7.82E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221862609 NA 5.99E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221862609 9.55E-06 NA mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221862609 NA 2.29E-08 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221862609 3.33E-09 1.96E-12 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221862609 2.51E-06 1.31E-11 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221862609 NA 8.45E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221862609 NA 4.47E-06 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221862609 NA 7.88E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221862609 9.49E-06 NA mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221862609 6.43E-06 4.40E-07 mr1647_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221862609 4.84E-06 4.84E-06 mr1647_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221862609 8.04E-07 NA mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221862609 NA 7.72E-10 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221862609 NA 5.56E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221862609 NA 3.90E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251